GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-01 07:25:14, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_017958890            3601 bp    mRNA    linear   PRI 20-NOV-2019
DEFINITION  PREDICTED: Papio anubis nuclear factor kappa B subunit 1 (NFKB1),
            transcript variant X4, mRNA.
ACCESSION   XM_017958890
VERSION     XM_017958890.3
DBLINK      BioProject: PRJNA576697
KEYWORDS    RefSeq.
SOURCE      Papio anubis (olive baboon)
  ORGANISM  Papio anubis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Papio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044978.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 20, 2019 this sequence version replaced XM_017958890.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Papio anubis Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3601
                     /organism="Papio anubis"
                     /mol_type="mRNA"
                     /isolate="15944"
                     /db_xref="taxon:9555"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="whole blood"
     gene            1..3601
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 309 ESTs, 5 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 25 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:101026781"
     CDS             163..3096
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X4"
                     /protein_id="XP_017814379.1"
                     /db_xref="GeneID:101026781"
                     /translation="
MKRTTSFRMAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDTESKKDSEGCDRSDDRNTVNLFGKVIETTEHNQEPSEATDGNGEVTLTYATRAKEESARVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMAASWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFRKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
     misc_feature    313..918
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(355..357,361..366,370..375,382..393,616..618,
                     622..627,916..918)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    937..1242
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(940..942,946..954,958..966,1084..1092,1129..1131,
                     1165..1167,1222..1224,1231..1233,1237..1239)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(946..951,955..957,994..996,1000..1002,1006..1008,
                     1105..1110,1117..1119,1123..1125)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(1009..1011,1015..1017,1108..1113)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1681..2463
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1813..1815,1819..1821,1831..1836,1843..1851,
                     1855..1860,1870..1872,1879..1881,1924..1926,1930..1932,
                     1936..1938,1948..1953,1960..1968,1972..1977,1987..1989,
                     1996..1998,2023..2025,2029..2031,2035..2037,2047..2052,
                     2059..2067,2071..2076,2086..2088,2095..2097)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1813..1926
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1930..2025
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2137..2229
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2239..2337
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2632..2859
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
cgctcgggctccggccggccaccgcctcttccctctccagcccgcaggcccgcgccgcccaggagggagagacccgcgccaggaggccgaacgcggactcgccaccaggaaggaacacaacgtcctacatcaagaagaaagacagaagcatatcttggagatatgaaaagaaccaccagcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccatatcttcaaatattagagcaacctaaacagcgaggatttcgtttccgttatgtttgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggttggcttcgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcgtgtataaggggctataatcctggactcttggtgcaccctgaccttgcctatttgcaagcagaaggtggaggggaccggcaattgggagatcgggaaaaagagctaatccgccaagcagctctgcagcaaaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtagtatcagacgccatctatgacagtaaagcccccaacgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggggaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatgttaatattacaaaaccagcctctgtgttcgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctctactatcctgaaatcaaagataaagaagaagtacagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggtgggagtggcgctggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacagggccagggtatagcttcccgcactatggatttcctacttatggtgggattaccttccatcctggaactactaaatctaatgctgggatgaagcatggaaccatggacactgaatctaaaaaggactctgaaggttgtgacagaagtgatgacagaaacactgtaaacctctttgggaaagtcattgaaaccacagagcacaatcaggagcccagcgaggccactgatgggaatggtgaggtcactctaacgtatgcaacaagagcaaaagaagagagtgctagggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactacgcagtgacaggagacgtgaagatgctgctggctgtccagcgccatctcactgccgtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggctggggccgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaatggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtttgctgctgctggtggccgctggggccgacgtcaatgctcaggagcaaaagtccgggcgcacagcactgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaaccacacccctgcatatagcagctgggagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtgcctggaaccacgcctctagatatggccgccagctggcaggtatttgacatattaaatgggaaaccatatgaaccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactctggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacagtcagagagctggtggaggccctgagacaaatgggctacactgaagcgattgaagtgatccaggcagcctccagcccagtgaagaccacctctcaggcccactcgctgcctctctcgcctgcctccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccgcaaactcagctttactgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgcagacaatttcccacaccgtataaaccaaagccctaaaattctactgcattgtccacaaaacagaagctgaagcgcatccagaggtgctcagagagccggcctgcctgcatcattctcgatagaactcgagaccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcacagcactggctgagcggatgcatctggggatgaggttgcttactaagctttgccggctgctgccggatcacagctgctttctgttgtcattgctattgtccctctgctacgttcctattgtcattaaaggtatcactgtccccacctggcattccttctgaccatccacagcatcgttttgcattcaaattaagggttaagaaaagggatattttaaaatgagagtcacttgacgtgccatttttaaaaaaggcatattgctttttctaatgtggttatttctctgatttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]