GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 06:14:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_017925662            2537 bp    mRNA    linear   INV 24-AUG-2016
DEFINITION  PREDICTED: Nicrophorus vespilloides embryonic polarity protein
            dorsal-like (LOC108565974), transcript variant X1, mRNA.
ACCESSION   XM_017925662
VERSION     XM_017925662.1
DBLINK      BioProject: PRJNA339573
KEYWORDS    RefSeq.
SOURCE      Nicrophorus vespilloides
  ORGANISM  Nicrophorus vespilloides
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Coleoptera; Polyphaga;
            Staphyliniformia; Silphidae; Nicrophorinae; Nicrophorus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017099889.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nicrophorus vespilloides Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2537
                     /organism="Nicrophorus vespilloides"
                     /mol_type="mRNA"
                     /isolate="i.1.1-1"
                     /isolation_source="Moore Laboratory-UGA-Outbred Laboratory
                     Colony"
                     /db_xref="taxon:110193"
                     /chromosome="Unknown"
                     /tissue_type="Whole Larva"
                     /dev_stage="wandering larva"
                     /country="USA: Georgia"
                     /collection_date="18-Jul-2012"
     gene            1..2537
                     /gene="LOC108565974"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 43 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 30 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:108565974"
     CDS             149..2485
                     /gene="LOC108565974"
                     /codon_start=1
                     /product="embryonic polarity protein dorsal-like isoform
                     X1"
                     /protein_id="XP_017781151.1"
                     /db_xref="GeneID:108565974"
                     /translation="
MDEHSLGPARQLQQRPIEESINISDVIEVIETDPDFKQATCLSSSSSSSPPQTTSSSVTRSNGSAGTGTMFNNSPIDPAQIRRQATVRIIEQPASKALRFRYECEGRSAGSIPGVNSTAENKTFPTIQIDGYKGKAVVVVSCVTKDHPHRPHPHNLVGRDGCKRGVCTMEISPDSMSISFSNLGIQCVKKKDIEAHLRVREEIRVDPFKTGYTHRSQPTSIDLNSVRLCFQVFTEGDKPGKFTVPLQPVVSDPIYDKKSMTDLTIVKLSDCVSSVDGGRKDIIVLCEKVSKEDIQIRFYEEKDGLVVWEGLGDFQPSQVHKQTAIWFKTPRYRTLDITEPVKVNIQLRRPSDGAISEPLPFELLPLDSGRPSFWSARRKKANYALFNSLLVPAAATTAAAPTIPAQPIVVTAEPEPIVNEVKERMEVEMPAYGEIKKHKPAMVIESNNNEVPLAPQQEIVQEVDEIYTENKKLVEAFDLNNVQAMDTEVVAESFDDSKTYSSLQMAFKNPMQMVEIDIEGDGTDRYEDIVVNPASPVIDLGVKRDVVEVDKLPPLPPKRAKKVIETDICDPVDPKYVTAPMTRSHSCNSLKPVLAPSKRLPPTPCSTLPNPKKRGFFSKLFGKKERSNASTRCSSIEPMAKGRSPFSSVNSLQVTPLNRTPSNRSANSVRIPLKDSLPDLTVVGQQEPPHDQQLNDLSKTTSINNNLNFAPNDLPDNEDEINMNLELTEAENYALYMAMAPHATQSEFDEMSAYYAPVEGGKILTDAEVLMRLAQNKT"
     misc_feature    407..922
                     /gene="LOC108565974"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD); Region: RHD-n; cl08275"
                     /db_xref="CDD:447596"
     misc_feature    order(443..445,449..454,458..463,467..478,707..709,
                     713..718,920..922)
                     /gene="LOC108565974"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143640"
     misc_feature    938..1246
                     /gene="LOC108565974"
                     /note="Rel homology dimerization domain; Region:
                     RHD_dimer; pfam16179"
                     /db_xref="CDD:435193"
     misc_feature    order(938..940,944..952,956..964,1085..1093,1130..1132,
                     1166..1168,1223..1225,1232..1234,1238..1240)
                     /gene="LOC108565974"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(944..949,953..955,995..997,1001..1003,1007..1009,
                     1106..1111,1118..1120,1124..1126)
                     /gene="LOC108565974"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(1010..1012,1016..1018,1109..1114)
                     /gene="LOC108565974"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
ORIGIN      
acaaacaaaaagtaaatattacaaaaataatgctaatcgaggttgcgtattaaaacaaaatataagcgacgcgcgatcgcaataatctgtgcacgacgttagagcaataaataaagagacttttaaaaagagcgatttcgtttccgtcatggacgaacacagtttaggtccagcgaggcaactgcagcagaggccaatcgaagagtctataaatataagtgatgtcattgaggtgatagaaaccgatccggatttcaagcaggcgacttgtctgtcgtcgtcgtcgtcgtcttcacctcctcagacgacgtcttcttctgttacgaggagcaacggttccgcaggaacaggaacgatgttcaacaacagtccgatagatccagctcagatccgccgtcaggcgacggtgcgcatcatcgagcagcccgcatctaaggcccttcgcttcaggtacgaatgcgagggtcgttcagccgggtccattcccggtgtcaacagtacagccgaaaacaagaccttccctaccatccagatcgatggatacaagggcaaggccgtcgtcgtcgtcagctgcgtcaccaaagaccatccccacaggccgcatccgcacaatttggtcggcagggacggctgcaagaggggcgtctgtactatggagatctcgcccgactcaatgtcgatatccttctcgaatttgggcattcagtgcgtgaagaagaaggacatcgaggctcatttgagggtgagggaagagatccgcgttgatccgttcaaaaccggttacacgcatcgcagccaaccaacgtccatagatctcaactcggtacgtctatgctttcaagtgttcaccgaaggcgacaaacctggaaagttcaccgtacctcttcaaccggtcgtcagcgatcccatctacgataagaagtcgatgaccgatctgaccattgtcaaactctctgattgcgtgagctcggtggacggtggtcgtaaagacattatcgtcctctgcgagaaggtgagcaaagaggacattcagatcagattctacgaggagaaggacggtttggtcgtgtgggagggtttgggtgatttccaaccgtcgcaagttcacaagcaaacggccatctggttcaagacgcccaggtacaggacgctcgacatcaccgaaccggtcaaggttaacatccaactgcggcgaccctccgatggagccatcagtgagccgctgccctttgaattgctgcccttggactcaggtaggccttcattttggtcagcgcgtcggaagaaggcgaattacgccctcttcaacagtcttctcgttcccgctgctgctacaacagcagcagcaccaacaataccagcacaacctatagttgtgaccgcggaaccggaaccaatcgttaatgaagttaaggagcgaatggaggtggagatgccggcgtacggggagatcaagaaacataaaccagcgatggtaatcgagagtaacaacaacgaggtgcctttggcaccgcagcaggagatcgtgcaagaggtggatgagatttacacggagaacaagaaactggtggaagcgttcgatttgaacaacgtgcaggcaatggatacagaagtcgtggccgaatcgttcgatgattccaagacgtacagcagtctgcagatggcgttcaagaaccccatgcagatggtggagatcgatatcgagggcgacggaacggataggtatgaggatatagtcgtgaatcctgcgagtccggtcatagatttgggcgtaaaacgcgacgtcgtcgaagtagacaagttgccgccgcttccaccgaaacgcgccaagaaggtcatcgaaacggacatttgcgatcccgtcgaccccaaatacgtgacagccccgatgacgcgctcccacagttgcaactcgctgaagccggtgttggcgccctcgaaacggttacctccgacaccgtgctccacgttgccgaacccaaagaaacgcggcttcttctcgaagttgttcggaaagaaggagcgaagcaacgcgagcactcgctgctccagcatcgaaccgatggcgaagggaagaagcccattctcgagcgtgaattcgctccaggtgactccgctgaacaggacgcccagcaatcgatccgcgaacagcgtccggattccactcaaagacagccttcccgatctgaccgtcgtaggccagcaggaacctccgcacgatcagcagctcaacgacctcagcaaaaccacgtcgatcaacaacaatttgaactttgctccgaacgatctaccagataacgaagacgaaattaacatgaacttggaactcaccgaagcggagaactacgccctttacatggcgatggctccgcacgcgacgcaaagcgagttcgacgagatgtccgcttattacgctcccgttgaaggcggcaaaatcttgacggacgccgaagtcctgatgcgactcgcccaaaacaaaacctgaagagaccaatcacttaaaggatctgaaacaaaacacacaaaaataaacaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]