2024-04-19 06:14:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017925662 2537 bp mRNA linear INV 24-AUG-2016 DEFINITION PREDICTED: Nicrophorus vespilloides embryonic polarity protein dorsal-like (LOC108565974), transcript variant X1, mRNA. ACCESSION XM_017925662 VERSION XM_017925662.1 DBLINK BioProject: PRJNA339573 KEYWORDS RefSeq. SOURCE Nicrophorus vespilloides ORGANISM Nicrophorus vespilloides Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Coleoptera; Polyphaga; Staphyliniformia; Silphidae; Nicrophorinae; Nicrophorus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_017099889.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nicrophorus vespilloides Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2537 /organism="Nicrophorus vespilloides" /mol_type="mRNA" /isolate="i.1.1-1" /isolation_source="Moore Laboratory-UGA-Outbred Laboratory Colony" /db_xref="taxon:110193" /chromosome="Unknown" /tissue_type="Whole Larva" /dev_stage="wandering larva" /country="USA: Georgia" /collection_date="18-Jul-2012" gene 1..2537 /gene="LOC108565974" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 43 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 30 samples with support for all annotated introns" /db_xref="GeneID:108565974" CDS 149..2485 /gene="LOC108565974" /codon_start=1 /product="embryonic polarity protein dorsal-like isoform X1" /protein_id="XP_017781151.1" /db_xref="GeneID:108565974" /translation="
MDEHSLGPARQLQQRPIEESINISDVIEVIETDPDFKQATCLSSSSSSSPPQTTSSSVTRSNGSAGTGTMFNNSPIDPAQIRRQATVRIIEQPASKALRFRYECEGRSAGSIPGVNSTAENKTFPTIQIDGYKGKAVVVVSCVTKDHPHRPHPHNLVGRDGCKRGVCTMEISPDSMSISFSNLGIQCVKKKDIEAHLRVREEIRVDPFKTGYTHRSQPTSIDLNSVRLCFQVFTEGDKPGKFTVPLQPVVSDPIYDKKSMTDLTIVKLSDCVSSVDGGRKDIIVLCEKVSKEDIQIRFYEEKDGLVVWEGLGDFQPSQVHKQTAIWFKTPRYRTLDITEPVKVNIQLRRPSDGAISEPLPFELLPLDSGRPSFWSARRKKANYALFNSLLVPAAATTAAAPTIPAQPIVVTAEPEPIVNEVKERMEVEMPAYGEIKKHKPAMVIESNNNEVPLAPQQEIVQEVDEIYTENKKLVEAFDLNNVQAMDTEVVAESFDDSKTYSSLQMAFKNPMQMVEIDIEGDGTDRYEDIVVNPASPVIDLGVKRDVVEVDKLPPLPPKRAKKVIETDICDPVDPKYVTAPMTRSHSCNSLKPVLAPSKRLPPTPCSTLPNPKKRGFFSKLFGKKERSNASTRCSSIEPMAKGRSPFSSVNSLQVTPLNRTPSNRSANSVRIPLKDSLPDLTVVGQQEPPHDQQLNDLSKTTSINNNLNFAPNDLPDNEDEINMNLELTEAENYALYMAMAPHATQSEFDEMSAYYAPVEGGKILTDAEVLMRLAQNKT"
misc_feature 407..922 /gene="LOC108565974" /note="N-terminal sub-domain of the Rel homology domain (RHD); Region: RHD-n; cl08275" /db_xref="CDD:447596" misc_feature order(443..445,449..454,458..463,467..478,707..709, 713..718,920..922) /gene="LOC108565974" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143640" misc_feature 938..1246 /gene="LOC108565974" /note="Rel homology dimerization domain; Region: RHD_dimer; pfam16179" /db_xref="CDD:435193" misc_feature order(938..940,944..952,956..964,1085..1093,1130..1132, 1166..1168,1223..1225,1232..1234,1238..1240) /gene="LOC108565974" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(944..949,953..955,995..997,1001..1003,1007..1009, 1106..1111,1118..1120,1124..1126) /gene="LOC108565974" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1010..1012,1016..1018,1109..1114) /gene="LOC108565974" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" ORIGIN
acaaacaaaaagtaaatattacaaaaataatgctaatcgaggttgcgtattaaaacaaaatataagcgacgcgcgatcgcaataatctgtgcacgacgttagagcaataaataaagagacttttaaaaagagcgatttcgtttccgtcatggacgaacacagtttaggtccagcgaggcaactgcagcagaggccaatcgaagagtctataaatataagtgatgtcattgaggtgatagaaaccgatccggatttcaagcaggcgacttgtctgtcgtcgtcgtcgtcgtcttcacctcctcagacgacgtcttcttctgttacgaggagcaacggttccgcaggaacaggaacgatgttcaacaacagtccgatagatccagctcagatccgccgtcaggcgacggtgcgcatcatcgagcagcccgcatctaaggcccttcgcttcaggtacgaatgcgagggtcgttcagccgggtccattcccggtgtcaacagtacagccgaaaacaagaccttccctaccatccagatcgatggatacaagggcaaggccgtcgtcgtcgtcagctgcgtcaccaaagaccatccccacaggccgcatccgcacaatttggtcggcagggacggctgcaagaggggcgtctgtactatggagatctcgcccgactcaatgtcgatatccttctcgaatttgggcattcagtgcgtgaagaagaaggacatcgaggctcatttgagggtgagggaagagatccgcgttgatccgttcaaaaccggttacacgcatcgcagccaaccaacgtccatagatctcaactcggtacgtctatgctttcaagtgttcaccgaaggcgacaaacctggaaagttcaccgtacctcttcaaccggtcgtcagcgatcccatctacgataagaagtcgatgaccgatctgaccattgtcaaactctctgattgcgtgagctcggtggacggtggtcgtaaagacattatcgtcctctgcgagaaggtgagcaaagaggacattcagatcagattctacgaggagaaggacggtttggtcgtgtgggagggtttgggtgatttccaaccgtcgcaagttcacaagcaaacggccatctggttcaagacgcccaggtacaggacgctcgacatcaccgaaccggtcaaggttaacatccaactgcggcgaccctccgatggagccatcagtgagccgctgccctttgaattgctgcccttggactcaggtaggccttcattttggtcagcgcgtcggaagaaggcgaattacgccctcttcaacagtcttctcgttcccgctgctgctacaacagcagcagcaccaacaataccagcacaacctatagttgtgaccgcggaaccggaaccaatcgttaatgaagttaaggagcgaatggaggtggagatgccggcgtacggggagatcaagaaacataaaccagcgatggtaatcgagagtaacaacaacgaggtgcctttggcaccgcagcaggagatcgtgcaagaggtggatgagatttacacggagaacaagaaactggtggaagcgttcgatttgaacaacgtgcaggcaatggatacagaagtcgtggccgaatcgttcgatgattccaagacgtacagcagtctgcagatggcgttcaagaaccccatgcagatggtggagatcgatatcgagggcgacggaacggataggtatgaggatatagtcgtgaatcctgcgagtccggtcatagatttgggcgtaaaacgcgacgtcgtcgaagtagacaagttgccgccgcttccaccgaaacgcgccaagaaggtcatcgaaacggacatttgcgatcccgtcgaccccaaatacgtgacagccccgatgacgcgctcccacagttgcaactcgctgaagccggtgttggcgccctcgaaacggttacctccgacaccgtgctccacgttgccgaacccaaagaaacgcggcttcttctcgaagttgttcggaaagaaggagcgaagcaacgcgagcactcgctgctccagcatcgaaccgatggcgaagggaagaagcccattctcgagcgtgaattcgctccaggtgactccgctgaacaggacgcccagcaatcgatccgcgaacagcgtccggattccactcaaagacagccttcccgatctgaccgtcgtaggccagcaggaacctccgcacgatcagcagctcaacgacctcagcaaaaccacgtcgatcaacaacaatttgaactttgctccgaacgatctaccagataacgaagacgaaattaacatgaacttggaactcaccgaagcggagaactacgccctttacatggcgatggctccgcacgcgacgcaaagcgagttcgacgagatgtccgcttattacgctcccgttgaaggcggcaaaatcttgacggacgccgaagtcctgatgcgactcgcccaaaacaaaacctgaagagaccaatcacttaaaggatctgaaacaaaacacacaaaaataaacaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]