2024-05-20 09:23:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017877137 1287 bp mRNA linear PRI 24-AUG-2016 DEFINITION PREDICTED: Rhinopithecus bieti copper-transporting ATPase 1 (LOC108532863), partial mRNA. ACCESSION XM_017877137 VERSION XM_017877137.1 DBLINK BioProject: PRJNA339282 KEYWORDS RefSeq. SOURCE Rhinopithecus bieti (black snub-nosed monkey) ORGANISM Rhinopithecus bieti Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Colobinae; Rhinopithecus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_016806636.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Rhinopithecus bieti Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..1287 /organism="Rhinopithecus bieti" /mol_type="mRNA" /isolate="Rb0" /db_xref="taxon:61621" /chromosome="Unknown" /sex="male" /tissue_type="blood" gene 1..>1287 /gene="LOC108532863" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:108532863" CDS 42..>1287 /gene="LOC108532863" /codon_start=1 /product="copper-transporting ATPase 1" /protein_id="XP_017732626.1" /db_xref="GeneID:108532863" /translation="
MPLLTSTNEFYTKGMTPVQDKEEAKTSSKCYIQVTGMTCASCVANIERNLRREEGIYSILVALMAGKAEVRYNPTVIQPPMIAEFIRELGFGATVIENADEGDGVLELVVRGMTCASCVHKIESSLTNHRGILYCSVALATNKAHIKYDPEIIGPRDIIHTIESLGFEASLVKKDRSASHLDHKREIRQWRRSFVVSLFFCIPVMGLMIYMMVMDHHFATLHHSQNMSKEEMINLHSSMFLERQILPGLSIMNLLSFLLCVPVQFFGGWYFYIQAYKALKHKTANMDVLIVLATTIAFAYSLVILLVAMYERAKVNPITFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLISLQATEATIVTLDSDNILLSEEQVDVELVQRGDIIKVVPGGKFPVDGHVIEGHSMVDESLIT"
misc_feature 135..323 /gene="LOC108532863" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(150..158,165..167) /gene="LOC108532863" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 360..551 /gene="LOC108532863" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(378..386,393..395) /gene="LOC108532863" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 615..>1287 /gene="LOC108532863" /note="Haloacid Dehalogenase-like Hydrolases; Region: HAD_like; cl21460" /db_xref="CDD:451251" ORIGIN
cgaatgagcccttggtagtaatagctcagccttcatcggaaatgccacttttgacttcaactaatgaattttatactaaagggatgacaccagttcaagacaaggaggaagcaaagacttcatctaagtgttacatacaggtcactggcatgacttgtgcttcctgtgtagcaaacattgaacggaatttaagacgggaagaaggaatatattctatacttgtggccctgatggctggcaaggcagaagtaagatataatcctactgttatacaacccccaatgatagcagagttcatccgagagcttggatttggagccactgtgatagaaaatgctgatgaaggagatggtgttttggaacttgttgtgagaggaatgacgtgtgcctcctgtgtacataaaatagagtcgagtctcacaaatcacagagggatcctgtactgctctgtggccttggcaaccaacaaagcacatattaaatatgacccagaaattattggtcccagagatattatccatacaattgaaagcttaggttttgaagcttctttggtcaagaaggatcggtcagcaagtcacctagatcataaacgagaaataagacaatggagacggtcttttgttgtgagtctgtttttttgtattcctgtaatggggctgatgatatatatgatggttatggaccaccactttgcaactcttcaccatagtcaaaacatgagtaaagaagaaatgatcaaccttcattcttctatgttcctggagcgccagattcttccaggattgtccattatgaatttgctgtcctttttattgtgtgtacctgtacagtttttcggaggctggtacttctacattcaggcttataaagcactgaagcataagacagcaaatatggacgtactgattgtgctggcaaccaccattgcatttgcctactctttggttattcttctagttgcaatgtatgaaagagccaaagtgaaccctattactttctttgacacaccccctatgctgtttgtgtttattgcactaggccgatggctggagcatatagcaaagggcaaaacatcagaggctcttgcaaagctaatttcactacaagctacagaagcaactattgtaactcttgattctgataatatcctcctcagtgaagaacaagtggatgtggaacttgtacaacgtggagatatcattaaagtagttccaggaggcaaatttccagtggatggtcatgttattgaaggacattctatggtagatgagtccctcatcacag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]