LOCUS       XM_017731265            5013 bp    mRNA    linear   VRT 03-AUG-2016
DEFINITION  PREDICTED: Corvus brachyrhynchos ATPase copper transporting beta
            (ATP7B), transcript variant X5, mRNA.
ACCESSION   XM_017731265
VERSION     XM_017731265.1
DBLINK      BioProject: PRJNA253849
KEYWORDS    RefSeq.
SOURCE      Corvus brachyrhynchos (American crow)
  ORGANISM  Corvus brachyrhynchos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Corvoidea;
            Corvidae; Corvus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008237436.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Corvus brachyrhynchos Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5013
                     /organism="Corvus brachyrhynchos"
                     /mol_type="mRNA"
                     /isolate="BGI_N302"
                     /db_xref="taxon:85066"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA"
     gene            1..5013
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:103613590"
     CDS             280..4278
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X5"
                     /protein_id="XP_017586754.1"
                     /db_xref="GeneID:103613590"
                     /translation="

MERKLDNKMKRELSYLATLNDRNISLVSIRKQQAARDVPELLIIGEKSKTASLVKTSSNLQKEEELPQSYSMGMTEVNTVERQALSNTDSPPDCELKPTMKHNFAFDNMGYEESSETMPSPPSPEHSVVVNIVGMTCQSCVQSIEGQISKVKGILRIKVSLEQNHAVIKYLQSEISPEQICQEILDMGFDANIAEDKLTTATVNLPSLKEAVVKLRVEGMTCQSCVTSIEGKIRKLHGVAKIKVSLDNQEAIVAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLKSDGLDPLVTEVGSTATVTLQIEGMHCKSCIRNIEGNISDLPGIKSIKVSLEHKCAVVQYTPDFITLSALQQAIESLPPGNFKVTLHNGSEAGKAASPSGAFTYDLIRQPPQGTTLTAVIKIDGMTCNSCVQSIEGAISQRQGVQHVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTVYCAFIQDTATGEHRCQPDASKAAVKPGAPEPPHQGCASDALPDSPHLDGSNRLSGATEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATVMEDNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLDHKKEIQQWRKSFLYSLVFGIPVVVIMIYMQIPNGGDRGSKVLERNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTTNMDVLIVLATTIAYLYSCVILIVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVPVELVQRGDVIKVVPGGKFPVDGKVIEGSSMADESLITGEPMPVIKKPGSTVIAGSINAHGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWTTIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITCGVPKVMRVLLMGDTTMLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGSELDVNISGDSSAPLGDNAVITLLESQGPSASQKYSVLIGNREWMRRNGLNIRNDVNDAMTNHEMKGQTAILVAIDGMLCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVLHHTADSASTVVCTFFWAVRSVLLLHVIF"

     misc_feature    664..852
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(682..690,697..699)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    919..1110
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(937..945,952..954)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1255..1431
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1273..1281,1288..1290)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1555..1746
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1573..1581,1588..1590)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1942..2133
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1960..1968,1975..1977)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2170..2361
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2188..2196,2203..2205)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2425..>4188
                     /gene="ATP7B"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
ORIGIN      

gccgaacgcagtttggaaagcacgagggatgccaattggtgggaaacatttaaactggcagggagagcaggtagctgagtgcagcaagcagcctacataaggatcacaggttccatctgggattttgtgatgaatgcctaatgagcacatggattagacggacagaactcttcaagcttctgtaaatgtagctgaaagaagcgtggcttacaggacaccaaataactgttcctgtaaaacttttgtttggcgttgcagtatttaaagtccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctacttagctactttaaacgacagaaacatatccctggtgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagacagcatcgctggtaaaaacaagcagtaacttgcagaaagaagaggaacttccgcagagttactccatgggaatgacagaagtcaatacagttgaaagacaggctttgtccaacactgattctcctcctgattgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggagagctctgaaaccatgccctctccaccttccccagagcacagtgtggtagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccaaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaaccatgctgttatcaagtatctgcagtcggaaataagtcctgaacagatttgccaggaaattctggatatgggctttgatgccaacatagcagaagataagttgacaacagcgactgtaaatttgccaagcttgaaagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccagcattgaaggaaagattaggaaactacacggtgtagcaaaaatcaaggtgtcacttgataaccaagaagcaattgttgcttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagcaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccctagggagacacctgcaagtctcaagagtgatgggctggatccactggttaccgaggtgggtagcacagctacagtgactttacagatagaaggcatgcactgcaagtcctgtatcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtataccccagatttcatcaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtaaccctccataatggttcagaagcaggcaaagcagcatctccctcaggtgctttcacatacgatctcatcagacagccaccgcaaggcacgacacttacggctgttattaagattgatggcatgacctgcaattcttgtgtacagtccatagaaggggccatatcacagagacaaggagtgcagcatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcacgagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtactgacagtgtattgtgcatttattcaagatactgctactggagaacacaggtgccagcctgatgccagcaaagctgccgtgaaacctggagctccagagcctcctcaccaaggctgtgcctcagatgctcttccagacagtcctcaccttgatgggtcaaacaggctcagtggagccacagaagaaaagtgtgttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatctgggttttgaagctactgtcatggaagataatgcagaaacagaagggcaggtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcgactagcaaagctcacatccagtttgatcctgaaattattggccctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctggatcacaaaaaggaaatacagcagtggaggaaatctttcttgtacagcctagtgtttggtattcctgttgtagtcataatgatttatatgcaaatacccaatggtggggaccgcgggtctaaggtgctggaacggaatctcattcctggattatctattttgaatcttctcttctttatcctctgcacttttgttcagttccttggtggatggtatttttacgtacaagcttacaagtcactgaggcacaagacgaccaatatggatgtgctcattgtactggccacgacgattgcttatctgtattcctgtgtgatcctgatagtagcaatcattgaaaaggcagagaaaagcccagtcactttcttcgacactcctccgatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtggtgactcttggacctgaccactccattgtcagggaggagcaagtacctgttgaacttgttcaaaggggtgatgttataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataaatttagtggctactttgttccatttatcatcatcatctcaactgtgacattgatagcatggaccacaattggttttgtaaattttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcatttcaaacctcgatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggtattctcatcaagggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgcttttgatgggggacacaaccatgctccccctgaagaaggtactggcagttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcactgacttccaggcagtcccaggctgtggtatcagctgcaaggtcggaggagttgaggccattcttggcagtgagctggatgttaacatcagtggggatagcagtgctcctctgggagataatgcagtgatcacgctcttggaatcacaaggtccatcagcttctcagaaatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgaatattagaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtatgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggcggcccttgctgtgcacacactgcaaagcatgggaatagacgtggtgctgataacaggagacaacaggaaaactgcaaaagccattgctactcaggtattgcaccacacagctgactcagccagcactgtggtatgcacattcttctgggctgtgaggtctgttttgcttctccatgtgattttttaatcctcctcctgttgtgtgtcacacttttcctttagtgttcagttatggtaaagtgctttcccacccaattttctttgtcaagggaaaaaagtctttcagaaacaagcttgaatttgtggttccagaaaataagatgaatgttttaaacaagcgtagtctgtgtcgacctacattttcattgaatttttggagcatacttactttccaatggaaggaaatggacagcagttctaaaaacgttataaaatgttactttttaaagggttaaaagagagcttctgtcttacatggtgaaaagctgcttctgcctggtaaggcagccaaacaaagggcattatcccagcactgtttaatacactcatctatttttaaactacaacactagatctgttggtagcaactccacattagttgagatgtggataagttgaagcatttagccagccatctgctttatttttataatctccctgagacttgcacatacttgttgtctctgtgtttcccctgctgtaactgcttgatcatacagggttcctgtgttgcattatctgcttgaagtctctgcaaagtgatctggataggctggattgatcagctgaggccagttgtgtgaggttcaaaaaggcaaagtgccaggccctgcacttgtgtcacaacaaccccaggcagcgctacaggctgggggcagagtggctgaaaagctgctcagcagaaaaggacctgggggtgctg

//