2024-05-15 14:34:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017508660 3877 bp mRNA linear PRI 20-NOV-2020 DEFINITION PREDICTED: Cebus imitator nuclear factor kappa B subunit 1 (NFKB1), transcript variant X1, mRNA. ACCESSION XM_017508660 VERSION XM_017508660.2 DBLINK BioProject: PRJNA328123 KEYWORDS RefSeq. SOURCE Cebus imitator (Panamanian white-faced capuchin) ORGANISM Cebus imitator Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Cebidae; Cebinae; Cebus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_016107712.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Nov 18, 2020 this sequence version replaced XM_017508660.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cebus imitator Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3877 /organism="Cebus imitator" /mol_type="mRNA" /isolate="Cc_AM_T3" /db_xref="taxon:2715852" /chromosome="Unknown" /sex="male" /dev_stage="adult" /country="Costa Rica" gene 1..3877 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 6 mRNAs, 277 ESTs, 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 26 samples with support for all annotated introns" /db_xref="GeneID:108289254" CDS 462..3368 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X1" /protein_id="XP_017364149.1" /db_xref="GeneID:108289254" /translation="
MAEDDPYLGRPEQMFHLDPLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDSESKKDPEGCDKSDDRDTVNLFGKVTETTEQDQEPSKATDGNGEVALTYATETKEESAGVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQENVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAVEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHRLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 585..1190 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(627..629,633..638,642..647,654..665,888..890, 894..899,1188..1190) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 1209..1514 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(1212..1214,1218..1226,1230..1238,1356..1364, 1401..1403,1437..1439,1494..1496,1503..1505,1509..1511) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1218..1223,1227..1229,1266..1268,1272..1274, 1278..1280,1377..1382,1389..1391,1395..1397) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1281..1283,1287..1289,1380..1385) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature order(2085..2087,2091..2093,2103..2108,2115..2123, 2127..2132,2142..2144,2151..2153,2196..2198,2202..2204, 2208..2210,2220..2225,2232..2240,2244..2249,2259..2261, 2268..2270,2295..2297,2301..2303,2307..2309,2319..2324, 2331..2339,2343..2348,2358..2360,2367..2369) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 2085..2198 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2088..>2657 /gene="NFKB1" /note="Transient Receptor Potential channel, Vanilloid subfamily (TRPV); Region: TRPV; cl40437" /db_xref="CDD:454755" misc_feature 2202..2297 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2217..2501 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature order(2409..2411,2415..2417,2427..2432,2439..2447, 2451..2456,2466..2468,2475..2477,2502..2504,2511..2513, 2517..2519,2529..2534,2541..2549,2553..2558,2571..2573, 2580..2582,2607..2609,2613..2615,2619..2621,2631..2636, 2643..2651,2655..2657) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 2409..2504 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2511..2609 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2904..3131 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
agagtgagcgacagagaaagagagagaagtgcaccagcgagccggggcaggaagaggaggtttcgccaccggagcggcccggcgacgcgctgacagcttcccctgcccttcccgtcggtcgggccgccagccgccgccgccctcggcctgcacgccgccgccagccccgctcccggagcccagcgccgccgaggccgcagccgcccggccaggaaggcggcgccgccgcccggccacagcgcgccctgcgcttccctccgcccgcgctgcggacatggcgcggcgctgactggcccagcctggccccgctgcgctctctctcgccccgacccacacccgggcccgctcgggctccggccggccgccgcctcttccttctccagcttttaggcccgcgccgcccgggagggagagcccacccgcgacagaggccgaacgctgactcgccacccggcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatcctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtatgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcgtgtataaggggctacaatcccggactcttggtgcaccctgaccttgcgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttacgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagataaagaagaagtgcagaggaaacgacaaaagctcatgcccaatttttcggatagtttcggcggtggtagtggtgccggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacaggtccagggtatagcttcccacactatggatttcctacttatggagggattaccttccatcctggaactactaaatctaatgctgggatgaaacatggaactatggacagtgaatctaaaaaggaccctgaaggttgtgacaaaagtgatgacagagacactgtaaacctctttggaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccaccgatgggaatggtgaggtcgctctaacgtatgcaacagaaaccaaagaagagagtgctggggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactatgcagtgacaggagacgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaaaatgtggtggaggatttgctgagggccggggctgacctgagccttctggaccgcttcggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtctggacgcacagccctgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtacctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactttggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacaccgaagcagttgaagtgatccaggcagcctccagcccagtgaagaccacctcgcaggcccactcactgcctctctcacctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaggctcagcttcaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccatgtaaaccaaagccctgaaattccactgcattgtccacaagaagaaagctgaagcgcatccaaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagcggatgcatctggggatgaggctgcttactgagctttgccggccgctgctggatcacagctgctttctgttgtcattgttgtccctctgctacgttcctgttgtcattaaagtgtcactggccccacctggcattccttctgaccacccacagcatcgttttgcattcaaattaagcgttaagaaaagggatattttaaaatgaaagtcacttgatgtgcaatttaaaaaaaaggcgtattactttttctaatgtggttatttctcggctttaaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]