GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 12:22:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_017381301            2430 bp    mRNA    linear   PLN 27-JUN-2016
DEFINITION  PREDICTED: Daucus carota subsp. sativus dihydrolipoyllysine-residue
            acetyltransferase component 1 of pyruvate dehydrogenase complex,
            mitochondrial (LOC108210053), mRNA.
ACCESSION   XM_017381301
VERSION     XM_017381301.1
DBLINK      BioProject: PRJNA326436
KEYWORDS    RefSeq.
SOURCE      Daucus carota subsp. sativus
  ORGANISM  Daucus carota subsp. sativus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; campanulids; Apiales; Apiaceae; Apioideae;
            Scandiceae; Daucinae; Daucus; Daucus sect. Daucus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030382.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Daucus carota subsp. sativus
                                           Annotation Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2430
                     /organism="Daucus carota subsp. sativus"
                     /mol_type="mRNA"
                     /cultivar="DH1"
                     /sub_species="sativus"
                     /db_xref="taxon:79200"
                     /chromosome="2"
                     /tissue_type="leaf"
                     /dev_stage="vegetative"
                     /country="Netherlands"
                     /genotype="Doubled haploid"
     gene            1..2430
                     /gene="LOC108210053"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 25 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:108210053"
     CDS             117..2018
                     /gene="LOC108210053"
                     /codon_start=1
                     /product="dihydrolipoyllysine-residue acetyltransferase
                     component 1 of pyruvate dehydrogenase complex,
                     mitochondrial"
                     /protein_id="XP_017236790.1"
                     /db_xref="GeneID:108210053"
                     /translation="
MALSRLRHPVISRAPSLFKSRYLSAISPNLSSSSGLNRTFDVDKDFFRPTARSGYNIISETPPRMKLQIGLRHFSSSEPPSHLVIEMPALSPTMTQGNIAKWHKKEGDKIEVGDVICEIETDKATLEFECLEEGFLAKILVPEGSKDIPVGKPIAITVEDADDIQNVPSNITNDSDVKEKQPAQQTDDRVQEPSSLNIDAAKLPPHAVLEMPALSPTMNQGNIVKWLKKEGDKIEVGDVICEIETDKATLEHECLEEGFLAKILAPEGSKDIAVGQPIAITVEDSNDIEAVKTSVTGKLPVKEEKSTPHEAKTEVNKSKSGFTRISPSAKLLITEHGLDASSLLASGPRGTLLKGDVLDAIKSGKGSAGASSTVKKSPPQAQPRSSSSASESVGTRKQQSDSFEDQPNSQIRKVIAKRLLESKQNTPHLYLSSDVILDPLLSFRKELKEKYDVKVSVNDIVIKAVAIALKNVPEANAFWSDEKGEIILCESVDISIAVATEKGLMTPIVRNADQKSISAISLEVKELAEKARTGKLLPNEFQGGTFSISNLGMFPVDRFCAIINPPQAGILAVGRGNQIVEPIVGADGIEKPGVITKMNLTLSADHRVFDGKVGGDFVKALSSNFSDIRRMLL"
     misc_feature    369..>755
                     /gene="LOC108210053"
                     /note="pyruvate dehydrogenase subunit beta; Provisional;
                     Region: PRK11892"
                     /db_xref="CDD:237011"
     misc_feature    738..1979
                     /gene="LOC108210053"
                     /note="pyruvate dehydrogenase complex dihydrolipoamide
                     acetyltransferase, long form; Region: PDHac_trf_mito;
                     TIGR01349"
                     /db_xref="CDD:273567"
ORIGIN      
tttattttacaattaattagtttagtggtttgctgaataatcaacaaaagtcgccaactcgccattcagaatcatacatacacacaattacatacagagagtaggtgtaagcatcgatggcgctctcacggctacgacatccggtgatctcgcgcgctccctctctctttaaatctcgctatctctctgcaatctctcccaatctctccagtagttcagggttaaatagaacgtttgatgtggataaagattttttcaggcctacagctcgttcaggatacaatattatatctgaaactccaccccggatgaagttgcaaattgggttgagacacttttcatcttcagagcctccatcacatcttgtcatcgaaatgccggctttgtcccctacaatgacgcaaggtaacatagcaaaatggcacaagaaggaaggagataagatagaagtgggggatgttatttgtgaaatagagacagacaaagctacccttgagtttgagtgtcttgaggaggggtttttagctaagatattggtacctgaaggttcaaaggacatacccgtgggaaagcctattgcaatcacggttgaagatgcagacgatatacaaaatgtcccatctaatattactaatgactcagacgttaaagaaaaacaaccagctcaacaaactgacgacagagtgcaggaacccagctctttgaatattgacgctgctaaacttccacctcatgctgttcttgaaatgccagcattatccccaaccatgaaccaaggtaacattgtcaagtggttgaaaaaggaaggggataagatagaggtcggtgatgtgatttgtgagatagagactgacaaagctactcttgaacatgaatgtcttgaagaggggttcctggccaagatacttgcacctgaaggttctaaagatattgcagttggacaacccattgcaattacagtggaggattcaaatgatattgaggctgtcaagacttctgttactggcaaacttccagtgaaggaggaaaaatcaactcctcatgaagccaaaactgaagttaataagtcaaaaagtggatttactaggattagtccatctgcaaagttgctaataactgaacatggattggatgcttcatctttactagcatcaggtcctcgtggtactttgctaaaaggtgatgttttagatgcaataaaatcagggaaaggttctgcaggagcttcttcaaccgtgaagaagtctccacctcaagctcagccacgatcttcttcatctgcatcggagagtgttggaactcgtaaacagcagtcagattctttcgaagaccaacctaatagtcaaattcgtaaggtgatagcgaaaagacttttggaatcaaaacaaaatacccctcacctatacttatcttcagatgttatactggatcctctactttcctttaggaaggagctcaaagagaaatacgatgttaaagtttcagtaaatgacattgtcattaaagctgtcgcaattgcactgaagaacgtaccagaagctaatgcattctggagtgatgagaaaggtgaaatcattttgtgtgaatctgttgatatatcaattgcggttgcaactgagaagggattgatgactccaattgtaaggaatgcagatcagaaatccataagtgcgatctcactagaggtcaaggaacttgcggaaaaggcacggacaggaaagctattaccaaacgagtttcaagggggcactttcagtatatcaaatttgggaatgtttccggtggaccgcttttgtgcaatcattaatcccccacaggctggcattctcgcagttggtaggggcaatcagattgttgaaccaatagttggcgctgatggtatcgagaagcctggtgtcatcacaaaaatgaatttgacactatccgctgatcaccgagtttttgatggaaaagtaggaggtgattttgtcaaagctttaagttcaaactttagtgacattcgaaggatgctattgtagaatcatgaaaggatctctctagtcaagacacgaaagtacctacagagcaagcattgtggtgtactatattcaaaaatatagactgacattctcggaaggctactttcctccgcacttctttgttgtgttatctggttttaccagtttttctttaatctatcggctccaaccttgctcgaggcttataaagtgcttattaaaacaattcaagtgatagcttacaccattttttccgttttttcttattggcagttgccatgaaaattatgctggccagtgtccattttgtataggaaataaagtgaaggatagcctggaaagatgtgcatagttttgataataaaattcattgaattggcaactttttgagccattaaaccatcatatctatggtagcaatttccataataaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]