2024-04-27 12:22:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017381301 2430 bp mRNA linear PLN 27-JUN-2016 DEFINITION PREDICTED: Daucus carota subsp. sativus dihydrolipoyllysine-residue acetyltransferase component 1 of pyruvate dehydrogenase complex, mitochondrial (LOC108210053), mRNA. ACCESSION XM_017381301 VERSION XM_017381301.1 DBLINK BioProject: PRJNA326436 KEYWORDS RefSeq. SOURCE Daucus carota subsp. sativus ORGANISM Daucus carota subsp. sativus Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; asterids; campanulids; Apiales; Apiaceae; Apioideae; Scandiceae; Daucinae; Daucus; Daucus sect. Daucus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_030382.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Daucus carota subsp. sativus Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2430 /organism="Daucus carota subsp. sativus" /mol_type="mRNA" /cultivar="DH1" /sub_species="sativus" /db_xref="taxon:79200" /chromosome="2" /tissue_type="leaf" /dev_stage="vegetative" /country="Netherlands" /genotype="Doubled haploid" gene 1..2430 /gene="LOC108210053" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 6 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 25 samples with support for all annotated introns" /db_xref="GeneID:108210053" CDS 117..2018 /gene="LOC108210053" /codon_start=1 /product="dihydrolipoyllysine-residue acetyltransferase component 1 of pyruvate dehydrogenase complex, mitochondrial" /protein_id="XP_017236790.1" /db_xref="GeneID:108210053" /translation="
MALSRLRHPVISRAPSLFKSRYLSAISPNLSSSSGLNRTFDVDKDFFRPTARSGYNIISETPPRMKLQIGLRHFSSSEPPSHLVIEMPALSPTMTQGNIAKWHKKEGDKIEVGDVICEIETDKATLEFECLEEGFLAKILVPEGSKDIPVGKPIAITVEDADDIQNVPSNITNDSDVKEKQPAQQTDDRVQEPSSLNIDAAKLPPHAVLEMPALSPTMNQGNIVKWLKKEGDKIEVGDVICEIETDKATLEHECLEEGFLAKILAPEGSKDIAVGQPIAITVEDSNDIEAVKTSVTGKLPVKEEKSTPHEAKTEVNKSKSGFTRISPSAKLLITEHGLDASSLLASGPRGTLLKGDVLDAIKSGKGSAGASSTVKKSPPQAQPRSSSSASESVGTRKQQSDSFEDQPNSQIRKVIAKRLLESKQNTPHLYLSSDVILDPLLSFRKELKEKYDVKVSVNDIVIKAVAIALKNVPEANAFWSDEKGEIILCESVDISIAVATEKGLMTPIVRNADQKSISAISLEVKELAEKARTGKLLPNEFQGGTFSISNLGMFPVDRFCAIINPPQAGILAVGRGNQIVEPIVGADGIEKPGVITKMNLTLSADHRVFDGKVGGDFVKALSSNFSDIRRMLL"
misc_feature 369..>755 /gene="LOC108210053" /note="pyruvate dehydrogenase subunit beta; Provisional; Region: PRK11892" /db_xref="CDD:237011" misc_feature 738..1979 /gene="LOC108210053" /note="pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase, long form; Region: PDHac_trf_mito; TIGR01349" /db_xref="CDD:273567" ORIGIN
tttattttacaattaattagtttagtggtttgctgaataatcaacaaaagtcgccaactcgccattcagaatcatacatacacacaattacatacagagagtaggtgtaagcatcgatggcgctctcacggctacgacatccggtgatctcgcgcgctccctctctctttaaatctcgctatctctctgcaatctctcccaatctctccagtagttcagggttaaatagaacgtttgatgtggataaagattttttcaggcctacagctcgttcaggatacaatattatatctgaaactccaccccggatgaagttgcaaattgggttgagacacttttcatcttcagagcctccatcacatcttgtcatcgaaatgccggctttgtcccctacaatgacgcaaggtaacatagcaaaatggcacaagaaggaaggagataagatagaagtgggggatgttatttgtgaaatagagacagacaaagctacccttgagtttgagtgtcttgaggaggggtttttagctaagatattggtacctgaaggttcaaaggacatacccgtgggaaagcctattgcaatcacggttgaagatgcagacgatatacaaaatgtcccatctaatattactaatgactcagacgttaaagaaaaacaaccagctcaacaaactgacgacagagtgcaggaacccagctctttgaatattgacgctgctaaacttccacctcatgctgttcttgaaatgccagcattatccccaaccatgaaccaaggtaacattgtcaagtggttgaaaaaggaaggggataagatagaggtcggtgatgtgatttgtgagatagagactgacaaagctactcttgaacatgaatgtcttgaagaggggttcctggccaagatacttgcacctgaaggttctaaagatattgcagttggacaacccattgcaattacagtggaggattcaaatgatattgaggctgtcaagacttctgttactggcaaacttccagtgaaggaggaaaaatcaactcctcatgaagccaaaactgaagttaataagtcaaaaagtggatttactaggattagtccatctgcaaagttgctaataactgaacatggattggatgcttcatctttactagcatcaggtcctcgtggtactttgctaaaaggtgatgttttagatgcaataaaatcagggaaaggttctgcaggagcttcttcaaccgtgaagaagtctccacctcaagctcagccacgatcttcttcatctgcatcggagagtgttggaactcgtaaacagcagtcagattctttcgaagaccaacctaatagtcaaattcgtaaggtgatagcgaaaagacttttggaatcaaaacaaaatacccctcacctatacttatcttcagatgttatactggatcctctactttcctttaggaaggagctcaaagagaaatacgatgttaaagtttcagtaaatgacattgtcattaaagctgtcgcaattgcactgaagaacgtaccagaagctaatgcattctggagtgatgagaaaggtgaaatcattttgtgtgaatctgttgatatatcaattgcggttgcaactgagaagggattgatgactccaattgtaaggaatgcagatcagaaatccataagtgcgatctcactagaggtcaaggaacttgcggaaaaggcacggacaggaaagctattaccaaacgagtttcaagggggcactttcagtatatcaaatttgggaatgtttccggtggaccgcttttgtgcaatcattaatcccccacaggctggcattctcgcagttggtaggggcaatcagattgttgaaccaatagttggcgctgatggtatcgagaagcctggtgtcatcacaaaaatgaatttgacactatccgctgatcaccgagtttttgatggaaaagtaggaggtgattttgtcaaagctttaagttcaaactttagtgacattcgaaggatgctattgtagaatcatgaaaggatctctctagtcaagacacgaaagtacctacagagcaagcattgtggtgtactatattcaaaaatatagactgacattctcggaaggctactttcctccgcacttctttgttgtgttatctggttttaccagtttttctttaatctatcggctccaaccttgctcgaggcttataaagtgcttattaaaacaattcaagtgatagcttacaccattttttccgttttttcttattggcagttgccatgaaaattatgctggccagtgtccattttgtataggaaataaagtgaaggatagcctggaaagatgtgcatagttttgataataaaattcattgaattggcaactttttgagccattaaaccatcatatctatggtagcaatttccataataaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]