GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 22:55:58, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_017021786            3241 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens ribosomal protein S6 kinase A5 (RPS6KA5),
            transcript variant X1, mRNA.
ACCESSION   XM_017021786
VERSION     XM_017021786.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000014.9) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 26, 2018 this sequence version replaced XM_017021786.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3241
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
     gene            1..3241
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="ribosomal protein S6 kinase A5; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 mRNAs, 47 ESTs, 66 long SRA reads, 3 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 9 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:9252"
                     /db_xref="HGNC:HGNC:10434"
                     /db_xref="MIM:603607"
     variation       1
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352081094"
     variation       5
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1009511657"
     variation       6
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255732958"
     variation       8
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424237707"
     variation       16
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405075108"
     variation       18
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409720426"
     variation       20
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412055527"
     variation       21
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055811589"
     variation       24
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051149649"
     variation       28
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936056701"
     variation       33
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1464045360"
     variation       37..39
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1000368262"
     variation       40
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397025723"
     variation       43
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904533546"
     variation       44
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348972507"
     variation       46
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041676056"
     variation       47
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176185161"
     variation       50..52
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:917350517"
     variation       51
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559960280"
     variation       56
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:925993491"
     variation       57
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977847205"
     variation       60
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319767547"
     variation       71
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287891261"
     variation       72
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967390993"
     variation       74
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922880125"
     variation       75
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976999301"
     variation       76
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481270968"
     variation       78
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926469499"
     variation       80
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354621713"
     variation       82
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964209160"
     variation       87
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377882809"
     variation       88
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018420333"
     variation       93..94
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1467287822"
     variation       99
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980692874"
     variation       104
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444569566"
     variation       108
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1370374862"
     variation       110
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409598191"
     variation       114
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142744185"
     variation       116
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309231034"
     variation       119
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:952417249"
     variation       121
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376139294"
     variation       122
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1217588773"
     variation       124
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300720474"
     variation       125
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312801786"
     variation       128
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761479240"
     variation       130
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751012214"
     variation       134
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1482643187"
     variation       140
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263787824"
     variation       142
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763702704"
     variation       145
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201279993"
     variation       150
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375495496"
     variation       153
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372229821"
     variation       154
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364911219"
     variation       156
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759337954"
     variation       157
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1386962045"
     variation       158
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961726948"
     variation       160
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776597056"
     variation       163
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772370418"
     variation       166..172
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:746069075"
     variation       168
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748448128"
     variation       169
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774261248"
     variation       170
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170398535"
     variation       171
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225487588"
     variation       172..176
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1447483888"
     variation       173
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768843079"
     variation       174
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389155534"
     variation       176
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429571266"
     variation       188
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749741829"
     variation       190
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274552217"
     variation       192
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762845963"
     variation       197
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293400999"
     variation       201
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372919173"
     variation       203
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435148220"
     variation       204
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375911233"
     variation       205
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008637753"
     variation       207
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483423077"
     variation       209
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277471045"
     variation       210
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746185525"
     variation       212
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341949601"
     variation       215
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275845362"
     variation       216
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781588549"
     variation       218
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332476359"
     variation       221
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756873050"
     variation       222
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751292340"
     variation       225
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202148951"
     variation       227
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757865793"
     variation       230
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752152274"
     variation       231
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765224867"
     variation       234
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029077430"
     variation       235
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776541777"
     variation       237..247
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ga"
                     /replace="gacggaggaga"
                     /db_xref="dbSNP:1279886265"
     variation       237
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555348355"
     variation       238
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761932282"
     variation       239
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367668503"
     variation       240
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768768064"
     variation       241
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749352681"
     variation       242
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199916387"
     variation       243
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392023520"
     variation       246
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483029166"
     variation       247
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369945741"
     variation       248
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306083113"
     variation       250
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202549406"
     variation       251
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343296599"
     variation       252..257
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ctc"
                     /replace="ctcctc"
                     /db_xref="dbSNP:1350681762"
     variation       252
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770267401"
     variation       257
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781535016"
     variation       258
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426419277"
     variation       260
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750709594"
     variation       261
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747349129"
     variation       263
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777417347"
     variation       264
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334733624"
     variation       269
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416021973"
     variation       271
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1399772704"
     variation       272
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200700842"
     variation       273
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752203024"
     variation       275
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764887929"
     variation       277
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217506851"
     variation       278
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754930685"
     variation       279
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753889864"
     variation       280
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766260545"
     variation       282
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190194033"
     variation       284
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399340604"
     variation       298
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888601559"
     variation       300
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781028330"
     variation       301
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389611261"
     variation       314
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756989172"
     variation       316
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413278594"
     variation       341
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230384018"
     variation       342
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544043188"
     variation       347
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334774898"
     variation       355
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777592660"
     variation       356
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240961750"
     variation       359..360
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="aacttaa"
                     /db_xref="dbSNP:756549423"
     variation       359
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210580531"
     variation       360..361
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="acccaaa"
                     /db_xref="dbSNP:753187591"
     variation       362..365
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1015355336"
     variation       374
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755162250"
     variation       378
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151225102"
     variation       379
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756086272"
     variation       391
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225629526"
     variation       393
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750519388"
     variation       394
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995029576"
     variation       397
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768094502"
     variation       400
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386909073"
     variation       401
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762462177"
     variation       410
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774828723"
     variation       417
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367694592"
     variation       422
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893950477"
     variation       430..454
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="aaaaggc"
                     /replace="aaaaggcaacaatcgttcaaaaggc"
                     /db_xref="dbSNP:781712449"
     variation       431
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567425374"
     variation       436
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371027093"
     variation       438
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764624247"
     variation       441
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460273306"
     variation       443
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372780620"
     variation       444
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199820517"
     variation       460
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762657053"
     variation       469
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309143667"
     variation       472
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198719757"
     variation       473
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748204518"
     variation       477
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483677586"
     variation       478
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774948932"
     variation       479
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769492817"
     variation       482..486
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ac"
                     /replace="acgac"
                     /db_xref="dbSNP:1357117799"
     variation       483
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339128052"
     variation       498
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142061817"
     variation       500
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005078126"
     variation       503
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265768241"
     variation       512
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776228610"
     variation       527
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325197470"
     variation       530
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280838259"
     variation       532
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770831665"
     variation       536
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351100919"
     variation       539
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330797012"
     variation       542
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746988502"
     variation       554
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1202980074"
     variation       560
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199516088"
     variation       566
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1464956168"
     variation       572
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758244156"
     variation       577
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771998704"
     variation       585
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252512273"
     variation       589
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204376586"
     variation       593
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358863784"
     variation       596
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1369494749"
     variation       599
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997287793"
     variation       612
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201222390"
     variation       620
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304663723"
     variation       621
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747853891"
     variation       622
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778788639"
     variation       627
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481994077"
     variation       629
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371214460"
     variation       631
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1240941638"
     variation       632
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7143758"
     variation       634
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746170983"
     variation       637
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781411551"
     variation       640
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007729748"
     variation       643
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757359077"
     variation       644
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1284709350"
     variation       647
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247975812"
     variation       650
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374545017"
     variation       651
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314684959"
     variation       653
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778384596"
     variation       655
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758967947"
     variation       656
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752984021"
     variation       661
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566778089"
     variation       662
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566778078"
     variation       666
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003458452"
     variation       674
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56369401"
     variation       675
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044722331"
     variation       676
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759105458"
     variation       681
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200296811"
     variation       690
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489843382"
     variation       695
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566772133"
     variation       705
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268012505"
     variation       706
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199633732"
     variation       711
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765972573"
     variation       712
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755783181"
     variation       716
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749909993"
     variation       728
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200169986"
     variation       731
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761646046"
     variation       734
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774290707"
     variation       739
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148618662"
     variation       741
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528231414"
     variation       743
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775448706"
     variation       748
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34699345"
     variation       749
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145964101"
     variation       750
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353092180"
     variation       752
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328559467"
     variation       754
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409034173"
     variation       755
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773158950"
     variation       785
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177976289"
     variation       786
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772251191"
     variation       793
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77756213"
     variation       794
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779406710"
     variation       796
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312037829"
     variation       804
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976830504"
     variation       809
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029132674"
     variation       813
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117056276"
     variation       817
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483194630"
     variation       818..822
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ata"
                     /replace="atata"
                     /db_xref="dbSNP:1252926605"
     variation       823
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238761527"
     variation       834..839
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="tttt"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:532770605"
     variation       843
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252162539"
     variation       844
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1337947137"
     variation       848
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177877830"
     variation       862
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018076176"
     variation       863
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020371978"
     variation       867
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1201978063"
     variation       868
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461010528"
     variation       886
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261414915"
     variation       896
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765188423"
     variation       897
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760965172"
     variation       904
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773425477"
     CDS             905..2656
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /codon_start=1
                     /product="ribosomal protein S6 kinase alpha-5 isoform X1"
                     /protein_id="XP_016877275.1"
                     /db_xref="GeneID:9252"
                     /db_xref="HGNC:HGNC:10434"
                     /db_xref="MIM:603607"
                     /translation="
MAPDIVRGGDSGHDKAVDWWSLGVLMYELLTGASPFTVDGEKNSQAEISRRILKSEPPYPQEMSALAKDLIQRLLMKDPKKRLGCGPRDADEIKEHLFFQKINWDDLAAKKVPAPFKPVIRDELDVSNFAEEFTEMDPTYSPAALPQSSEKLFQGYSFVAPSILFKRNAAVIDPLQFHMGVERPGVTNVARSAMMKDSPFYQHYDLDLKDKPLGEGSFSICRKCVHKKSNQAFAVKIISKRMEANTQKEITALKLCEGHPNIVKLHEVFHDQLHTFLVMELLNGGELFERIKKKKHFSETEASYIMRKLVSAVSHMHDVGVVHRDLKPENLLFTDENDNLEIKIIDFGFARLKPPDNQPLKTPCFTLHYAAPELLNQNGYDESCDLWSLGVILYTMLSGQVPFQSHDRSLTCTSAVEIMKKIKKGDFSFEGEAWKNVSQEAKDLIQGLLTVDPNKRLKMSGLRYNEWLQDGSQLSSNPLMTPDILGSSGAAVHTCVKATFHAFNKYKREGFCLQNVDKAPLAKRRKMKKTSTSTETRSSSSESSHSSSSHSHGKTTPTKTLQPSNPADSNNPETLFQFSDSVA"
     misc_feature    <905..1387
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:328722"
     misc_feature    1499..2428
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="C-terminal catalytic domain of the Serine/Threonine
                     Kinase, Mitogen and stress-activated kinase 1; Region:
                     STKc_MSK1_C; cd14179"
                     /db_xref="CDD:271081"
     misc_feature    order(1541..1555,1565..1567,1604..1606,1610..1612,
                     1691..1693,1739..1750,1760..1762,1766..1768,1874..1879,
                     1883..1885,1889..1894,1898..1900,1937..1942,1949..1951,
                     1994..2008,2012..2014,2393..2395)
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="active site"
                     /db_xref="CDD:271081"
     misc_feature    order(1541..1549,1604..1606,1739..1750,1760..1762,
                     1889..1894,1898..1900,1937..1939,2393..2395)
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:271081"
     misc_feature    order(1553..1555,1760..1762,1766..1768,1874..1879,
                     1883..1885,1889..1891,1949..1951,1994..2008,2012..2014)
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:271081"
     misc_feature    1937..2008
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:271081"
     variation       911
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772187708"
     variation       920
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748214958"
     variation       927
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993884899"
     variation       930
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450041819"
     variation       932
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144064383"
     variation       937
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390541733"
     variation       943
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266958479"
     variation       952
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171646962"
     variation       957
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457216641"
     variation       958
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356606981"
     variation       968
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373916642"
     variation       970
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158606577"
     variation       972
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032824605"
     variation       973
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998694723"
     variation       974
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967260755"
     variation       979
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201424443"
     variation       982
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372452750"
     variation       984
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455680711"
     variation       993
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431416370"
     variation       994
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395439884"
     variation       1000
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563154065"
     variation       1017
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1267374524"
     variation       1019
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746195386"
     variation       1026
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140126863"
     variation       1035
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251568234"
     variation       1036
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770587636"
     variation       1042
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1305353131"
     variation       1050
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746707654"
     variation       1052
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017996699"
     variation       1057
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257031550"
     variation       1078
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146107979"
     variation       1084
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381077261"
     variation       1086
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371531566"
     variation       1103
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747410357"
     variation       1104
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281348481"
     variation       1105
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763660726"
     variation       1107
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771878009"
     variation       1111
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747609197"
     variation       1116..1117
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1389453669"
     variation       1120
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149616968"
     variation       1121
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534048620"
     variation       1122
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200357482"
     variation       1126
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780056328"
     variation       1127
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996283858"
     variation       1135
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571679369"
     variation       1136
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365990500"
     variation       1139
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138308039"
     variation       1151
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750249924"
     variation       1167
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150910355"
     variation       1169
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370238703"
     variation       1173
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411560797"
     variation       1174
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473029472"
     variation       1175
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237245826"
     variation       1176
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758673014"
     variation       1179
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752746147"
     variation       1181
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765370847"
     variation       1185
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1360775608"
     variation       1189
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1407799005"
     variation       1192
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760077770"
     variation       1193
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776943706"
     variation       1205
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754944278"
     variation       1206
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997329245"
     variation       1210
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753979562"
     variation       1212
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766743012"
     variation       1216
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761309319"
     variation       1220
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483247182"
     variation       1222
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773680228"
     variation       1223
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768059667"
     variation       1228
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774082309"
     variation       1229
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376247617"
     variation       1230
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762322464"
     variation       1233
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375770844"
     variation       1237
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775115824"
     variation       1238
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769592023"
     variation       1240
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316268142"
     variation       1241
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348316639"
     variation       1244
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773482291"
     variation       1247
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780955166"
     variation       1258
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770657867"
     variation       1260
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746809054"
     variation       1266
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909143652"
     variation       1269
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577750321"
     variation       1272
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208196188"
     variation       1274
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755247579"
     variation       1282
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243365361"
     variation       1291
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753836236"
     variation       1296
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780222805"
     variation       1305
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557893123"
     variation       1306
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768149658"
     variation       1310
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762231001"
     variation       1314
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566717598"
     variation       1315
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200895075"
     variation       1324
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215416072"
     variation       1330
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141403978"
     variation       1331
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762707763"
     variation       1333
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218085545"
     variation       1339
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774862939"
     variation       1342
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:55936408"
     variation       1344
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146532003"
     variation       1349
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349695832"
     variation       1350
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981586839"
     variation       1352
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770884768"
     variation       1363
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373348904"
     variation       1367
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431385349"
     variation       1368
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776138152"
     variation       1371
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177626577"
     variation       1372
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471024748"
     variation       1380
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236620385"
     variation       1392
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186275327"
     variation       1393
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55985734"
     variation       1394
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461904361"
     variation       1396
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1253282085"
     variation       1402
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:773169044"
     variation       1404
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:769998617"
     variation       1404
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760703708"
     variation       1408
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772877415"
     variation       1410
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018108592"
     variation       1413
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771959307"
     variation       1424
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747906939"
     variation       1430
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1308942225"
     variation       1432
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775713390"
     variation       1439
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382996502"
     variation       1440
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770164792"
     variation       1441
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995096349"
     variation       1451
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745922176"
     variation       1452
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011167649"
     variation       1460
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159699562"
     variation       1461
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402330643"
     variation       1463..1466
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="acaa"
                     /db_xref="dbSNP:1566714100"
     variation       1463
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781462520"
     variation       1466
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757836027"
     variation       1476
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747613814"
     variation       1481
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778160536"
     variation       1484
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274383549"
     variation       1488
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261787695"
     variation       1492
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893531545"
     variation       1499
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758848393"
     variation       1510
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223749414"
     variation       1513
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985155775"
     variation       1515
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141570904"
     variation       1516
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338800427"
     variation       1517
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754617697"
     variation       1519
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753545853"
     variation       1523
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1320680307"
     variation       1530
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030868486"
     variation       1533
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766033940"
     variation       1538
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143530311"
     variation       1543
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546279654"
     variation       1546
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410363348"
     variation       1555
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360489117"
     variation       1562
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200091410"
     variation       1569
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369503281"
     variation       1573
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751395491"
     variation       1574
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1406845788"
     variation       1577
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392660268"
     variation       1579
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764039486"
     variation       1581
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762858981"
     variation       1588
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776931899"
     variation       1589
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771092000"
     variation       1593
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760763362"
     variation       1594
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423590511"
     variation       1596
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773211826"
     variation       1608
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772598315"
     variation       1615
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554880063"
     variation       1622
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201610483"
     variation       1624
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963622583"
     variation       1628
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1397845269"
     variation       1630
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1222606268"
     variation       1631
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745565405"
     variation       1632
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172474992"
     variation       1634
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284159698"
     variation       1638
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372449079"
     variation       1645
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191930267"
     variation       1648
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751150206"
     variation       1652
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777806922"
     variation       1657
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:531921814"
     variation       1659
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461053466"
     variation       1667
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187714869"
     variation       1671
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443623106"
     variation       1673
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188456832"
     variation       1677
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253408285"
     variation       1683
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:939826341"
     variation       1685
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936571241"
     variation       1686
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351236661"
     variation       1688
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758462031"
     variation       1693
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237680849"
     variation       1700
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148385885"
     variation       1703
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315968352"
     variation       1704
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450344063"
     variation       1705
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367954583"
     variation       1707
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174011689"
     variation       1708
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333535840"
     variation       1711
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383283438"
     variation       1712
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750549414"
     variation       1715
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296810191"
     variation       1716
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767783761"
     variation       1718
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761841279"
     variation       1719
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379356994"
     variation       1720
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374856978"
     variation       1725
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329043053"
     variation       1728
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374156204"
     variation       1729
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772830897"
     variation       1733
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401871688"
     variation       1739
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262890443"
     variation       1748
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771647081"
     variation       1753
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460296685"
     variation       1754..1760
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ggag"
                     /replace="ggaggag"
                     /db_xref="dbSNP:767419873"
     variation       1766
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747695262"
     variation       1770
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778673783"
     variation       1771
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476907994"
     variation       1772
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754963730"
     variation       1773
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537754207"
     variation       1789
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459210118"
     variation       1790
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256236878"
     variation       1791
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1198080263"
     variation       1802
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447027477"
     variation       1804
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150175403"
     variation       1809
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757458685"
     variation       1811
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200260836"
     variation       1813
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777977577"
     variation       1819
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566704061"
     variation       1828
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344789464"
     variation       1837
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371247192"
     variation       1841
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447079397"
     variation       1850
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765644584"
     variation       1851
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760132998"
     variation       1865
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445389914"
     variation       1867
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754144321"
     variation       1868
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178108548"
     variation       1870
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751017200"
     variation       1878
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424216101"
     variation       1884
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="tcgg"
                     /db_xref="dbSNP:867278576"
     variation       1885
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376401703"
     variation       1888
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772929657"
     variation       1897
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306924623"
     variation       1903
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957531772"
     variation       1906
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750838914"
     variation       1907
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55911249"
     variation       1909
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761566070"
     variation       1910
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1255803875"
     variation       1920
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226099402"
     variation       1925
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978041244"
     variation       1926
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773729525"
     variation       1929
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768156182"
     variation       1955
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748183093"
     variation       1956
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868072956"
     variation       1957
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030051811"
     variation       1962
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194938398"
     variation       1964
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762375512"
     variation       1966
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288010576"
     variation       1968
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34604933"
     variation       1969
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146437557"
     variation       1972
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162841258"
     variation       1973
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745642692"
     variation       1976
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781008603"
     variation       1981
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196511434"
     variation       1984
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772183324"
     variation       1985
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748456297"
     variation       1987
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192132225"
     variation       1990
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998198073"
     variation       1993
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167673741"
     variation       1996
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775651251"
     variation       2001
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779012780"
     variation       2002
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575612190"
     variation       2007
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266818999"
     variation       2008
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018986568"
     variation       2012
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755016647"
     variation       2013
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333558064"
     variation       2014
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143990644"
     variation       2015
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220407517"
     variation       2023
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338260997"
     variation       2028
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392360459"
     variation       2030
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189487598"
     variation       2032
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201623063"
     variation       2033
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240440502"
     variation       2038
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139792854"
     variation       2039
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765581206"
     variation       2042
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767990787"
     variation       2043
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55968863"
     variation       2044
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936278757"
     variation       2053
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145941322"
     variation       2058
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:904683955"
     variation       2060
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378758119"
     variation       2067
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763687878"
     variation       2068
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762401928"
     variation       2073
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775033644"
     variation       2074
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765131434"
     variation       2075
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759541597"
     variation       2076
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435259524"
     variation       2085
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182308463"
     variation       2090
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573196540"
     variation       2091
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335281079"
     variation       2103
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334842503"
     variation       2108
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398320270"
     variation       2118
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781690351"
     variation       2125
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312723746"
     variation       2126
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747371219"
     variation       2127
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373786141"
     variation       2136
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758035959"
     variation       2137
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752292382"
     variation       2138
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362709766"
     variation       2142
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376770842"
     variation       2143
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425541997"
     variation       2144
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778537958"
     variation       2145
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209960135"
     variation       2146
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560567621"
     variation       2147
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753307259"
     variation       2148
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766315907"
     variation       2149
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373068417"
     variation       2150
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284915992"
     variation       2152
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303654716"
     variation       2157
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546733309"
     variation       2158
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369868780"
     variation       2159
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293188530"
     variation       2169
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761713973"
     variation       2172
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775814724"
     variation       2177
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920219205"
     variation       2182
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139155141"
     variation       2186
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759640790"
     variation       2187
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151173238"
     variation       2191
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564898212"
     variation       2192
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961440854"
     variation       2194
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771466676"
     variation       2200
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183708892"
     variation       2201
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747531260"
     variation       2203
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778270417"
     variation       2207
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772352475"
     variation       2212
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748540299"
     variation       2215
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778485150"
     variation       2221
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754672721"
     variation       2224
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753356455"
     variation       2226
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290821786"
     variation       2229
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1236929974"
     variation       2230
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1202896948"
     variation       2231
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779496203"
     variation       2233
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376381621"
     variation       2234
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1272580665"
     variation       2239
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767594984"
     variation       2245
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748487293"
     variation       2251
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774735396"
     variation       2257
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768348389"
     variation       2259
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748949889"
     variation       2260
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779769989"
     variation       2262
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755512871"
     variation       2267
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745406792"
     variation       2283
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781254517"
     variation       2287
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249795933"
     variation       2288
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757302417"
     variation       2298
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201885024"
     variation       2302
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377850025"
     variation       2309
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394695194"
     variation       2311
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764041515"
     variation       2313
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758229532"
     variation       2314
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753943943"
     variation       2322
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:533096467"
     variation       2326
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766651260"
     variation       2329
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760618612"
     variation       2334
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564177046"
     variation       2336
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767977575"
     variation       2337
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544286455"
     variation       2338
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774683979"
     variation       2343
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566673911"
     variation       2346
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867506498"
     variation       2349
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298075797"
     variation       2350
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917502711"
     variation       2356
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768843620"
     variation       2368
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142908236"
     variation       2369
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769535940"
     variation       2372
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566673830"
     variation       2376
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527985475"
     variation       2377
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562360365"
     variation       2378
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780918760"
     variation       2387
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757249503"
     variation       2388
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004150102"
     variation       2392
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159511387"
     variation       2397
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746888024"
     variation       2399
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777773959"
     variation       2400
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867099727"
     variation       2407
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562239102"
     variation       2408
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566672020"
     variation       2415
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321813401"
     variation       2418
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772100058"
     variation       2424
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1392759723"
     variation       2424
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1231397516"
     variation       2428
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992676327"
     variation       2429
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747867978"
     variation       2430
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778837620"
     variation       2434
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311786779"
     variation       2435..2438
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:35806749"
     variation       2446
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383676013"
     variation       2447
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937248322"
     variation       2452
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148567600"
     variation       2453
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437406085"
     variation       2458
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750588342"
     variation       2459
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781398254"
     variation       2463
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370587714"
     variation       2487
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424961195"
     variation       2488
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173323460"
     variation       2490
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751709680"
     variation       2491
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764476146"
     variation       2494
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763582371"
     variation       2501
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933555892"
     variation       2503..2508
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="taccga"
                     /replace="taccgataccga"
                     /db_xref="dbSNP:775724285"
     variation       2503
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246656634"
     variation       2505
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488572636"
     variation       2506
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765578032"
     variation       2511
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759980356"
     variation       2512
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144832163"
     variation       2513
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149441965"
     variation       2514
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375975906"
     variation       2526
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772822945"
     variation       2544
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771901541"
     variation       2545
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373451698"
     variation       2546
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748271652"
     variation       2550
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566671565"
     variation       2552
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748176348"
     variation       2553
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923582174"
     variation       2560
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965020437"
     variation       2561
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778730906"
     variation       2562
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768374038"
     variation       2575
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460879088"
     variation       2577
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372886372"
     variation       2578
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177229887"
     variation       2579
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749113650"
     variation       2580
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457514878"
     variation       2583
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778900661"
     variation       2584
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559863309"
     variation       2585
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751585615"
     variation       2591
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200115430"
     variation       2592
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197487303"
     variation       2594
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758419560"
     variation       2596
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391275040"
     variation       2600
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250607600"
     variation       2603
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755066054"
     variation       2605
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149061350"
     variation       2606
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35358985"
     variation       2607
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200886537"
     variation       2608
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208435887"
     variation       2609
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543409817"
     variation       2610
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760474693"
     variation       2612
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266646054"
     variation       2616
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772586913"
     variation       2619
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756443629"
     variation       2620
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761235262"
     variation       2622
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303836978"
     variation       2626
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774305241"
     variation       2627
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768603375"
     variation       2630
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324047982"
     variation       2631
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749051475"
     variation       2635
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453352381"
     variation       2640
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147233692"
     variation       2641
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143846565"
     variation       2647
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747193614"
     variation       2651
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249693873"
     variation       2652
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777859214"
     variation       2659
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002737953"
     variation       2664
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367591784"
     variation       2671
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:772575903"
     variation       2672
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201075477"
     variation       2680
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574445731"
     variation       2682
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186008852"
     variation       2683
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374026125"
     variation       2688
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412735736"
     variation       2693
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369570559"
     variation       2698
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228045512"
     variation       2699
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756451627"
     variation       2703
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998580083"
     variation       2717
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554836655"
     variation       2718
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289713170"
     variation       2721
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450410390"
     variation       2723
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218684631"
     variation       2726
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1483120761"
     variation       2726
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375924085"
     variation       2734
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180979002"
     variation       2747
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750733123"
     variation       2764
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473652236"
     variation       2770
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163625666"
     variation       2771
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243383030"
     variation       2778..2784
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1412906645"
     variation       2799
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146942753"
     variation       2803
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531603481"
     variation       2815
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141832261"
     variation       2817
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1409338347"
     variation       2818
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1306387343"
     variation       2821
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449139252"
     variation       2827
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:769528460"
     variation       2827
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039296069"
     variation       2843
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943337122"
     variation       2848
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276035446"
     variation       2853
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909235011"
     variation       2856
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984815701"
     variation       2861
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390048133"
     variation       2862
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247896323"
     variation       2870
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758869722"
     variation       2875
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965110617"
     variation       2881
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929364519"
     variation       2894
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919376855"
     variation       2897
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566670750"
     variation       2899
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164306505"
     variation       2903
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:981269411"
     variation       2936
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537676979"
     variation       2947
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428828569"
     variation       2952
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539388386"
     variation       2956
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429178781"
     variation       2961
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:971256419"
     variation       2969
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566670667"
     variation       2976
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415758687"
     variation       2983
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:570748905"
     variation       2989
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473004956"
     variation       2992
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991432504"
     variation       2993..2995
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="ctc"
                     /db_xref="dbSNP:1333808888"
     variation       2994
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415290939"
     variation       3004
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957237865"
     variation       3005
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032620381"
     variation       3010
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298987473"
     variation       3011
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365112856"
     variation       3021
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998504982"
     variation       3027
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902939110"
     variation       3033
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029371109"
     variation       3034
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346635547"
     variation       3049
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147965359"
     variation       3056
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998059389"
     variation       3060..3066
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="caa"
                     /replace="caaacaa"
                     /db_xref="dbSNP:1277532674"
     variation       3069
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459801483"
     variation       3074
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209151568"
     variation       3077
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902022747"
     variation       3084
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1001126472"
     variation       3086
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467133534"
     variation       3090
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537044952"
     variation       3096..3101
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1269405761"
     variation       3112
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191068353"
     variation       3122
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228482257"
     variation       3127
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183140638"
     variation       3131
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277437551"
     variation       3135
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547996114"
     variation       3138
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333173799"
     variation       3139
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1388484016"
     variation       3160..3161
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:781027533"
     variation       3163
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191388481"
     variation       3165
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233407833"
     variation       3189
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896572695"
     variation       3199
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320975637"
     variation       3211..3218
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="ctttttct"
                     /db_xref="dbSNP:1457858377"
     variation       3217
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11848393"
     variation       3218
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322571438"
     variation       3219
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464308385"
     variation       3225
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055171468"
     variation       3226
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1452251935"
     variation       3226
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157015735"
     variation       3227..3241
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="aaaaaaaaaaaaa"
                     /replace="aaaaaaaaaaaaaa"
                     /replace="aaaaaaaaaaaaaaa"
                     /replace="aaaaaaaaaaaaaaaa"
                     /replace="aaaaaaaaaaaaaaaaa"
                     /db_xref="dbSNP:rs10710825"
     variation       3233
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1002583595"
     variation       3234
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479161340"
     variation       3240
                     /gene="RPS6KA5"
                     /gene_synonym="MSK1; MSPK1; RLPK"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74486405"
ORIGIN      
gaggaggcgaggagcgagccgtgcggccagagcgggaaagagactcgtctttgcgtccgagttctggagccgccgcaccccgactcctggggccgcggcagcggctgcgaggggacgggcgtccgctgtctcctgggttcccctcgtagcgacccgcgggatcggaaaaaaaggagaagatggaggaggagggtggcagcagcggcggcgccgcggggaccagcgcggacggcggcgacggaggagagcagctcctcactgtcaagcacgagctgcggactgctaatttgacaggacatgctgagaaggtgggaatagaaaattttgagctcctgaaggtcctaggaactggagcttatggaaaagtatttctagttcgtaaaataagtggccatgatactggaaagctgtatgccatgaaagttttgaaaaaggcaacaatcgttcaaaaggccaaaaccacagagcatacaaggacagaacgacaagtcctggaacacattaggcagtcgccatttttggtaacattacattatgctttccagacagaaaccaaacttcatctcattttagattatataaatggtggtgaactttttactcatctttctcaaagagagcgtttcacagagcatgaggtgcagatttatgttggagagattgtgcttgccctcgaacatctccacaagttggggattatatatcgtgatattaagcttgagaatattctacttgattctaatggccatgtggtgctgacagattttggtctgagtaaggagtttgtggctgatgaagtgtgccttttataaataacatatagctggattttattttttgatcgagagtttctgtcttttaactgactgaaagagcatattccttttgtggaactattgaatacatggcaccagatattgtcagagggggagattcaggacatgacaaggcagttgactggtggagtttgggtgttctaatgtatgaattactaactggagcatctcctttcactgttgatggagaaaaaaattcccaagctgagatatctaggagaatattaaaaagtgagcctccatatccccaagaaatgagtgctttagcgaaagacctaattcagcgtcttttgatgaaagatcccaagaagagattgggatgtggtccacgtgatgcagatgaaatcaaagaacatctcttctttcagaaaataaattgggatgatttagccgccaaaaaagtgcctgcaccatttaagccagtcattcgagatgaattagatgtgagtaactttgcagaagagttcacagaaatggatcccacttattctcccgcagccctgccccagagttctgagaagctgtttcagggctattcctttgttgctccttccatcctattcaagcgtaatgcagctgtcatagaccctcttcagtttcacatgggagttgaacgtcctggagtgacaaatgttgccaggagtgcaatgatgaaggactctccattctatcaacactatgacctagatttgaaggacaaacccctgggagaaggtagtttttcaatttgtcgaaagtgtgtgcataaaaaaagtaaccaagcttttgcagtcaaaataatcagcaaaaggatggaagccaatactcaaaaggaaataacagctctgaaactctgtgaaggacaccccaatattgtgaagttgcatgaagtttttcatgatcagcttcacacgtttctagtgatggaacttctgaatggaggagaactgtttgagcgcattaagaaaaagaagcacttcagtgagacggaagccagctacatcatgaggaagcttgtttcagctgtaagccacatgcatgatgttggagtggtgcacagggatctgaaacctgagaatttattgttcaccgatgaaaatgacaatttggaaattaaaataattgattttggatttgcacggctaaagccaccggataatcagcccctgaagactccatgcttcacccttcattatgccgccccagagctcttgaatcagaacggctacgatgagtcctgtgacctgtggagcttgggcgtcattttgtacacaatgttgtcaggacaggttcccttccaatctcatgaccgaagtttgacgtgtaccagcgcggtggaaatcatgaagaaaattaaaaagggagatttctcctttgaaggagaagcctggaagaatgtatcccaagaggctaaagatttgatccaaggacttctcacagtagatccaaacaaaaggcttaaaatgtctggcttgaggtacaatgaatggctacaagatggaagtcagctgtcctccaatcctctgatgactccggatattctaggatcttccggagctgccgtgcatacctgtgtgaaagcaaccttccacgcctttaacaaatacaagagagaggggttttgccttcagaatgttgataaggcccctttggctaagagaagaaaaatgaaaaagactagcaccagtaccgagacgcgcagcagttccagtgagagttcccattcttcttcctctcattctcacggtaaaactacacccaccaagacactgcagcccagcaatcctgccgacagcaataacccggagaccctcttccagttctcggactcagtagcttaggcatggtaggagtgtatcagtgatccattgcacctttattccctcagcatatgcctgaggcgatcttttatgcttttaaaaatgtttcccgttggtctcattggaatctgcctcctaatgatttttttcaggaaaacctgtttggttatcctcattcaaaagcactggacagagaatgttactgtgaatagagcacatattactctttttagcaacctagcatgatgccaacaagactattcttgaaagagcaaaggttcctgtaaatttaattagggctagatttgagctgcttgtaagtcacaggttttccagatgtctgccaacaagaaatgactcatactgtgatgataccttttgctttgccttgtggacaatgtgggtttttgaaatttgcacccttcaaacaatgatttatcagagaaaggggtctgttttcaaaaaagattctgtaatgaattttatgtgtggcatatacttatttcttgagagaagattttaacttattgtttttattttatggttacatatgatgataacctgctattattaaactttttctaaaaagtgaaaaaaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]