GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:27:43, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_017015490            6096 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens transforming acidic coiled-coil containing
            protein 2 (TACC2), transcript variant X24, mRNA.
ACCESSION   XM_017015490
VERSION     XM_017015490.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000010.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6096
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
     gene            1..6096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="transforming acidic coiled-coil containing protein
                     2; Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 mRNA, 12 ESTs, 1 long SRA read, 1
                     Protein, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 2 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
     variation       1
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949736791"
     variation       3
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981404472"
     variation       16..17
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1203509893"
     variation       20
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192795609"
     variation       40
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908449369"
     variation       41
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193133228"
     variation       53
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776600076"
     variation       57
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429199747"
     variation       59
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898602883"
     variation       61
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542237873"
     variation       62
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185682553"
     variation       63
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371112179"
     variation       64
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891152794"
     variation       67
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565018724"
     variation       68
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008643574"
     variation       74
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1383631860"
     variation       75
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021241526"
     variation       78
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902739373"
     variation       81
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896720881"
     variation       83
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759136137"
     variation       84
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756798875"
     variation       86
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745326586"
     variation       87
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173514668"
     variation       89
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755669282"
     variation       96
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780679760"
     variation       99
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320471019"
     variation       100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200528686"
     variation       104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372926797"
     variation       105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151268273"
     variation       106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451117201"
     variation       109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774802156"
     variation       110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368679552"
     variation       123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368424069"
     variation       124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376941035"
     CDS             125..6028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /codon_start=1
                     /product="transforming acidic coiled-coil-containing
                     protein 2 isoform X23"
                     /protein_id="XP_016870979.1"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
                     /translation="
MGNENSTSDNQQEDSVLHNVILWPPNPEPTQRTLSAQTPRSAQPPGNSQNIKRKQQDTPGSPDHRDASSIGSVGLGGFCTASESSASLDPCLVSPEVTEPRKDPQGARGPEGSLLPSPPPSQEREHPSSSMPFAECPPEGCLASPAAAPEDGPQTQSPRREPAPNAPGDIAAAFPAERDSSTPYQEIAAVPSAGRERQPKEEGQKSSFSFSSGIDQSPGMSPVPLREPMKAPLCGEGDQPGGFESQEKEAAGGFPPAESRQGVASVQVTPEAPAAAQQGTESSAVLEKSPLKPMAPIPQDPAPRASDRERGQGEAPPQYLTDDLEFLRACHLPRSNSGAAPEAEVNAASQESCQQPVGAYLPHAELPWGLPSPALVPEAGGSGKEALDTIDVQGHPQTGMRGTKPNQVVCVAAGGQPEGGLPVSPEPSLLTPTEEAHPASSLASFPAAQIPIAVEEPGSSSRESVSKAGMPVSADAAKEVVDAGLVGLERQVSDLGSKGEHPEGDPGEVPAPSPQERGEHLNTEQSHEVQPGVPPPPLPKEQSHEVQPGAPPPPLPKAPSESARGPPGPTDGAKVHEDSTSPAVAKEGSRSPGDSPGGKEEAPEPPDGGDPGNLQGEDSQAFSSKRDPEVGKDELSKPSSDAESRDHPSSHSAQPPRKGGAGHTDGPHSQTAEADASGLPHKLGEEDPVLPPVPDGAGEPTVPEGAIWEGSGLQPKCPDTLQSREGLGRMESFLTLESEKSDFPPTPVAEVAPKAQEGESTLEIRKMGSCDGEGLLTSPDQPRGPACDASRQEFHAGVPHPPQGENLAADLGLTALILDQDQQGIPSCPGEGWIRGAASEWPLLSSEKHLQPSQAQPETSIFDVLKEQAQPPENGKETSPSHPGFKDQGADSSQIHVPVEPQEDNNLPTHGGQEQALGSELQSQLPKGTLSDTPTSSPTDMVWESSLTEESELSAPTRQKLPALGEKRPEGACGDGQSSRVSPPAADVLKDFSLAGNFSRKETCCTGQGPNKSQQALADALEEGSQHEEACQRHPGASEAADGCSPLWGLSKREMASGNTGEAPPCQPDSVALLDAVPCLPALAPASPGVTPTQDAPETEACDETQEGRQQPVPAPQQKMECWATSDAESPKLLASFPSAGEQGGEAGAAETGGSAGAGDPGKQQAPEKPGEATLSCGLLQTEHCLTSGEEASTSALRESCQAEHPMASCQDALLPARELGGIPRSTMDFSTHQAVPDPKELLLSGPPEVAAPDTPYLHVDSAAQRGAEDSGVKAVSSADPRAPGESPCPVGEPPLALENAASLKLFAGSLAPLLQPGAAGGEIPAVQASSGSPKARTTEGPVDSMPCLDRMPLLAKGKQATGEEKAATAPGAGAKASGEGMAGDAAGETEGSMERMGEPSQDPKQGTSGGVDTSSEQIATLTGFPDFREHIAKIFEKPVLGALATPGEKAGAGRSAVGKDLTRPLGPEKLLDGPPGVDVTLLPAPPARLQVEKKQQLAGEAEISHLALQDPASDKLLGPAGLTWERNLPGAGVGKEMAGVPPTLREDERPEGPGAAWPGLEGQAYSQLERSRQELASGLPSPAATQELPVERAAAFQVAPHSHGEEAVAQDRIPSGKQHQETSACDSPHGEDGPGDFAHTGVPGHVPRSTCAPSPQREVLTVPEANSEPWTLDTLGGERRPGVTAGILEMRNALGNQSTPAPPTGEVADTPLEPGKVAGAAGEAEGDITLSTAETQACASGDLPEAGTTRTFSVVAGDLVLPGSCQDPACSDKAPGMEGTAALHGDSPARPQQAKEQPGPERPIPAGDGKVCVSSPPEPDETHDPKLQHLAPEELHTDRESPRPGPSMLPSVPKKDAPRVMDKVTSDETRGAEGTESSPVADDIIQPAAPADLESPTLAASSYHGDVVGQVSTDLIAQSISPAAAHAGLPPSAAEHIVSPSAPAGDRVEASTPSCPDPAKDLSRIP"
     variation       126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349609278"
     variation       134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384553919"
     variation       136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203183802"
     variation       137..138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1269775765"
     variation       145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215968267"
     variation       147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547823080"
     variation       148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886895560"
     variation       150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283714338"
     variation       152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212493882"
     variation       153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773505492"
     variation       158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421978010"
     variation       159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168680390"
     variation       163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043082105"
     variation       164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162984295"
     variation       169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567395106"
     variation       170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458435301"
     variation       181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536431472"
     variation       182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748823611"
     variation       183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389657707"
     variation       187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896032069"
     variation       190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192677940"
     variation       194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350812446"
     variation       203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184660626"
     variation       205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291011051"
     variation       213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323178740"
     variation       214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244843089"
     variation       215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755476481"
     variation       216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991342276"
     variation       219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192689513"
     variation       220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375461398"
     variation       224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307737191"
     variation       232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754559620"
     variation       236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779540446"
     variation       237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753289073"
     variation       239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756120822"
     variation       242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173681722"
     variation       243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758684627"
     variation       247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114344239"
     variation       248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202197379"
     variation       249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccctc"
                     /db_xref="dbSNP:748791718"
     variation       249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138166528"
     variation       250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745896242"
     variation       253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769907900"
     variation       259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774154821"
     variation       260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761870489"
     variation       261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771921628"
     variation       266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375973608"
     variation       267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201980895"
     variation       269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238814181"
     variation       270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766081390"
     variation       275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369830070"
     variation       276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554980725"
     variation       277..281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:753443406"
     variation       278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759087516"
     variation       283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370111299"
     variation       285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764868224"
     variation       286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115077750"
     variation       288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758882459"
     variation       297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540521848"
     variation       298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751908069"
     variation       300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158155825"
     variation       301..302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:763342425"
     variation       301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577387065"
     variation       302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573681653"
     variation       308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200691895"
     variation       313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352400701"
     variation       315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1320631404"
     variation       317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393009319"
     variation       322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140883324"
     variation       323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780126824"
     variation       324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749336283"
     variation       325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200367"
     variation       326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760524024"
     variation       328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331467958"
     variation       329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229314757"
     variation       330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272791539"
     variation       333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138597000"
     variation       335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372977281"
     variation       337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952513086"
     variation       339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968854951"
     variation       340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369866874"
     variation       341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769447853"
     variation       344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450537702"
     variation       346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401814880"
     variation       350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539346663"
     variation       351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138796945"
     variation       353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226301817"
     variation       354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763550115"
     variation       355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774831593"
     variation       358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437030329"
     variation       359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205587179"
     variation       363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277726271"
     variation       364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762252775"
     variation       365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115572080"
     variation       367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1237711421"
     variation       370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750751342"
     variation       374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186166664"
     variation       375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335659286"
     variation       379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392544523"
     variation       385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450701880"
     variation       388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173397369"
     variation       395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191313839"
     variation       397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756461782"
     variation       398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754047980"
     variation       400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182633225"
     variation       403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344864902"
     variation       406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779193768"
     variation       407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748251065"
     variation       409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757192262"
     variation       420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781309215"
     variation       425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:574835006"
     variation       427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769522022"
     variation       432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1485880225"
     variation       434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1220763436"
     variation       436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201040329"
     variation       437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464196742"
     variation       438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777133517"
     variation       440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866845498"
     variation       443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139133884"
     variation       444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143057039"
     variation       448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773786012"
     variation       450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761348528"
     variation       451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772523083"
     variation       452..453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1228306033"
     variation       457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773759070"
     variation       459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761069382"
     variation       460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766722368"
     variation       475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754078377"
     variation       476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307904014"
     variation       480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccgc"
                     /db_xref="dbSNP:1161463614"
     variation       480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:532147977"
     variation       481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565235917"
     variation       483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369387017"
     variation       484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373182521"
     variation       488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329310218"
     variation       492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200671128"
     variation       494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377057058"
     variation       495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781250337"
     variation       497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035710398"
     variation       498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750363676"
     variation       500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898091499"
     variation       502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755931307"
     variation       504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375164406"
     variation       507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141987188"
     variation       508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201984659"
     variation       509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778562836"
     variation       513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202231209"
     variation       514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747638919"
     variation       515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453887168"
     variation       516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200011504"
     variation       517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771610804"
     variation       520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773704307"
     variation       521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199673873"
     variation       526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182894618"
     variation       527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373788566"
     variation       529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460951688"
     variation       530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161584714"
     variation       532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388467605"
     variation       533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147458352"
     variation       536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324127475"
     variation       537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376962666"
     variation       538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139828953"
     variation       542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763092038"
     variation       544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142984046"
     variation       545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755940383"
     variation       549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1263231461"
     variation       552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461610469"
     variation       557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478832013"
     variation       561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359072315"
     variation       564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528115484"
     variation       565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753531775"
     variation       567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1482252348"
     variation       568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754820367"
     variation       574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778507311"
     variation       575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471076806"
     variation       576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423514696"
     variation       578..579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1185497500"
     variation       578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233315473"
     variation       580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370193834"
     variation       582..584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ctc"
                     /db_xref="dbSNP:752075521"
     variation       585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164077070"
     variation       586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747863916"
     variation       588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427545282"
     variation       589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198091564"
     variation       594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907693838"
     variation       595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309677133"
     variation       604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771559274"
     variation       605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547871776"
     variation       606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746532477"
     variation       608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341684181"
     variation       609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244916642"
     variation       612..615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:757693244"
     variation       613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297465705"
     variation       616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771302189"
     variation       617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963734438"
     variation       620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309046698"
     variation       622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777216753"
     variation       623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328109752"
     variation       625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215691127"
     variation       627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746213186"
     variation       633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283912221"
     variation       634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770318243"
     variation       635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198883792"
     variation       636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78149003"
     variation       637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774257197"
     variation       639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139910468"
     variation       640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774962316"
     variation       641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753858328"
     variation       648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170249935"
     variation       649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149820575"
     variation       650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765076181"
     variation       652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300665813"
     variation       662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403948166"
     variation       666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146707567"
     variation       667..670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tact"
                     /replace="tacttact"
                     /db_xref="dbSNP:781399781"
     variation       667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41288000"
     variation       668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370732959"
     variation       670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763800934"
     variation       671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781519455"
     variation       672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746440335"
     variation       676..677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:750447544"
     variation       677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770267070"
     variation       678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144016066"
     variation       682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483728396"
     variation       683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1468971932"
     variation       685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749704333"
     variation       688..702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgc"
                     /replace="tgccgtccccagtgc"
                     /db_xref="dbSNP:1241686627"
     variation       691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146425124"
     variation       692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11200385"
     variation       698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285355053"
     variation       699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767703887"
     variation       700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776420572"
     variation       707..715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="agagaga"
                     /replace="agagagaga"
                     /db_xref="dbSNP:1432349259"
     variation       710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173746849"
     variation       716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759412867"
     variation       720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765166194"
     variation       721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752447470"
     variation       725..731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:1385726721"
     variation       725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763630843"
     variation       730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946315751"
     variation       731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199693945"
     variation       734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756712964"
     variation       735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780809477"
     variation       738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303938289"
     variation       739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312994030"
     variation       742..757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctccttctccttctcc"
                     /replace="ctccttctccttctccttctcc"
                     /db_xref="dbSNP:756169189"
     variation       742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535065792"
     variation       744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756620419"
     variation       745..749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:780453024"
     variation       747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372806087"
     variation       748..752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:904541826"
     variation       748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056487135"
     variation       750..751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1331262700"
     variation       750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780732675"
     variation       751..755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:749452283"
     variation       755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749651425"
     variation       756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769108695"
     variation       758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996551474"
     variation       760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779002808"
     variation       766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559804804"
     variation       768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418935659"
     variation       773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772197780"
     variation       776..777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1480646280"
     variation       776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180939566"
     variation       785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773211037"
     variation       786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458329823"
     variation       787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159256265"
     variation       788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1210607758"
     variation       792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760776569"
     variation       794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456902268"
     variation       801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484897417"
     variation       809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554657489"
     variation       813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212250186"
     variation       815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775453520"
     variation       817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:768582523"
     variation       818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764016618"
     variation       819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201276537"
     variation       820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761467777"
     variation       821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412639970"
     variation       823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767078887"
     variation       830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772816568"
     variation       834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749906694"
     variation       836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143195709"
     variation       838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490439884"
     variation       839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204226690"
     variation       840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887986265"
     variation       843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357167335"
     variation       846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780679682"
     variation       847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754467303"
     variation       849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374397256"
     variation       855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1187512168"
     variation       856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474401079"
     variation       857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412361944"
     variation       858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779280100"
     variation       862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543513548"
     variation       865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772300166"
     variation       871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429480913"
     variation       873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777991788"
     variation       874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747068095"
     variation       875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367976637"
     variation       885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307587628"
     variation       886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283831210"
     variation       887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775402055"
     variation       889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357019026"
     variation       890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230128352"
     variation       891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763000875"
     variation       892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1565239223"
     variation       892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768487816"
     variation       893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360133978"
     variation       899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390662729"
     variation       900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371086694"
     variation       905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963804882"
     variation       906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202928711"
     variation       907..911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1227375547"
     variation       908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401149550"
     variation       909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961816829"
     variation       911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774125717"
     variation       916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761541862"
     variation       923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767259677"
     variation       924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151218566"
     variation       926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201513169"
     variation       933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241727330"
     variation       934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386387813"
     variation       937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449454104"
     variation       938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370529132"
     variation       939..942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:778835852"
     variation       946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167097911"
     variation       947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753305212"
     variation       948..965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cag"
                     /replace="cagcccagcagggcacag"
                     /db_xref="dbSNP:748180148"
     variation       956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374044820"
     variation       959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980875898"
     variation       961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779322137"
     variation       963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367593472"
     variation       965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777936931"
     variation       968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747294941"
     variation       969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757312128"
     variation       975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371430835"
     variation       976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200705484"
     variation       981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227489270"
     variation       985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768595912"
     variation       988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956566613"
     variation       989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774206095"
     variation       990..995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1370204599"
     variation       990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747945270"
     variation       992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868558986"
     variation       994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11816938"
     variation       995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1389693868"
     variation       1002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310129764"
     variation       1008..1011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1398024688"
     variation       1008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866405275"
     variation       1010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453441105"
     variation       1011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146983657"
     variation       1012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138069008"
     variation       1016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758992994"
     variation       1017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187170370"
     variation       1019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250472736"
     variation       1021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542065957"
     variation       1022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172409444"
     variation       1023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1423311299"
     variation       1027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380377116"
     variation       1034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753182204"
     variation       1036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191200763"
     variation       1039
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177423326"
     variation       1041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750417915"
     variation       1046..1050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1387926412"
     variation       1051
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433020020"
     variation       1055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318414946"
     variation       1057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758754668"
     variation       1058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431175414"
     variation       1062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764496827"
     variation       1063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365049271"
     variation       1067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751934143"
     variation       1068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143121367"
     variation       1069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781422767"
     variation       1071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150583771"
     variation       1072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138162632"
     variation       1073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778907040"
     variation       1075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347037820"
     variation       1078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050895902"
     variation       1079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565240698"
     variation       1080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550713473"
     variation       1081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919300435"
     variation       1082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479216436"
     variation       1093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200346563"
     variation       1098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772149524"
     variation       1102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455683413"
     variation       1108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161527036"
     variation       1113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773078761"
     variation       1116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1387033561"
     variation       1125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929297984"
     variation       1129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401284240"
     variation       1133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746834833"
     variation       1137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1347847504"
     variation       1139
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324407499"
     variation       1141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770661570"
     variation       1145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776198678"
     variation       1147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283488236"
     variation       1149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759053524"
     variation       1152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383137398"
     variation       1153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149557136"
     variation       1162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565241088"
     variation       1165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776048491"
     variation       1166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570548726"
     variation       1168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209705359"
     variation       1173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763389378"
     variation       1175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455156905"
     variation       1178
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764588961"
     variation       1184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751880808"
     variation       1185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757639386"
     variation       1188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471768319"
     variation       1199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184077085"
     variation       1200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767750830"
     variation       1201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472519482"
     variation       1209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770976617"
     variation       1210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201912981"
     variation       1211..1213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cac"
                     /replace="cacac"
                     /db_xref="dbSNP:1263477888"
     variation       1212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1426288932"
     variation       1213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377717933"
     variation       1214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549925900"
     variation       1220..1250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgccctggggcttgccaagtcctgccctgg"
                     /replace="ctgccctggggcttgccaagtcctgccctggggcttgccaagtcctgc
                     cctgg"
                     /db_xref="dbSNP:771868818"
     variation       1222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330492288"
     variation       1223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552803087"
     variation       1225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758375476"
     variation       1239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777878485"
     variation       1244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282912667"
     variation       1247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746781383"
     variation       1251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247158967"
     variation       1260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770886696"
     variation       1267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482282700"
     variation       1269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995053150"
     variation       1271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197718510"
     variation       1273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226863673"
     variation       1279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780889466"
     variation       1280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324907028"
     variation       1281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566405955"
     variation       1288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298001733"
     variation       1289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185570831"
     variation       1292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758613158"
     variation       1293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007789977"
     variation       1295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774795630"
     variation       1298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762479718"
     variation       1301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969735887"
     variation       1303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389257434"
     variation       1304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460295396"
     variation       1306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980713186"
     variation       1310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376621212"
     variation       1312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535017370"
     variation       1318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762162854"
     variation       1324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901976240"
     variation       1325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144408700"
     variation       1326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760742195"
     variation       1328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453929654"
     variation       1329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866587992"
     variation       1332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202181318"
     variation       1333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753924739"
     variation       1337..1339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1230121690"
     variation       1337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252082508"
     variation       1339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148794347"
     variation       1341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751612350"
     variation       1345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757057983"
     variation       1352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474737220"
     variation       1353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461837076"
     variation       1356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868821748"
     variation       1357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189862285"
     variation       1358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780788735"
     variation       1360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745676307"
     variation       1362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426487505"
     variation       1364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172330678"
     variation       1366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368657688"
     variation       1367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779778333"
     variation       1368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747138914"
     variation       1372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337545458"
     variation       1375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537032352"
     variation       1376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757642911"
     variation       1377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1050664023"
     variation       1379..1383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:772831539"
     variation       1379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141547215"
     variation       1380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762250594"
     variation       1382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746392374"
     variation       1383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772637339"
     variation       1386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:980617843"
     variation       1387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341585496"
     variation       1396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330888994"
     variation       1397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773412896"
     variation       1400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761126564"
     variation       1403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766491271"
     variation       1404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944683633"
     variation       1409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267403196"
     variation       1412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754156600"
     variation       1413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188044643"
     variation       1414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170827353"
     variation       1419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146365477"
     variation       1420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432401223"
     variation       1424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765463510"
     variation       1426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200855604"
     variation       1434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576922376"
     variation       1436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202167155"
     variation       1437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750136554"
     variation       1439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755984690"
     variation       1446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436111855"
     variation       1450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551434293"
     variation       1451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199400051"
     variation       1455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866006967"
     variation       1456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929354267"
     variation       1457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547161743"
     variation       1458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390404370"
     variation       1466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565243131"
     variation       1467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049107667"
     variation       1469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357528024"
     variation       1474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754640237"
     variation       1476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778329449"
     variation       1478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346442184"
     variation       1479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227848615"
     variation       1483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1440613961"
     variation       1484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905019210"
     variation       1486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331422198"
     variation       1490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747725878"
     variation       1493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139655744"
     variation       1495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773822206"
     variation       1504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391745803"
     variation       1508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747306614"
     variation       1509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771396861"
     variation       1510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776976997"
     variation       1511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943607533"
     variation       1512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759772113"
     variation       1513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765556704"
     variation       1516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377138456"
     variation       1520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1405687927"
     variation       1523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405087894"
     variation       1525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763114778"
     variation       1526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77657275"
     variation       1530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750412382"
     variation       1535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423107266"
     variation       1547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755855849"
     variation       1548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200950997"
     variation       1549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753635947"
     variation       1551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146444857"
     variation       1559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375566982"
     variation       1560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1224439722"
     variation       1566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767169175"
     variation       1567..1568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtggg"
                     /db_xref="dbSNP:746527471"
     variation       1569..1570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ctggg"
                     /db_xref="dbSNP:770390528"
     variation       1569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565243782"
     variation       1571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767997069"
     variation       1573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428898394"
     variation       1580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139482219"
     variation       1581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176496381"
     variation       1585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243488718"
     variation       1586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757969790"
     variation       1589..1593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gagag"
                     /replace="gagagag"
                     /db_xref="dbSNP:1452451864"
     variation       1591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778142032"
     variation       1595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203934329"
     variation       1596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1230850944"
     variation       1598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481309988"
     variation       1599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75334581"
     variation       1601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771575517"
     variation       1605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777064999"
     variation       1606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1222485044"
     variation       1607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746262560"
     variation       1611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770091461"
     variation       1612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775830036"
     variation       1619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310638638"
     variation       1624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168555745"
     variation       1628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356539356"
     variation       1629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762909149"
     variation       1634..1637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1232852759"
     variation       1634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892222231"
     variation       1637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149664604"
     variation       1638..1642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="accct"
                     /db_xref="dbSNP:1565244337"
     variation       1639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145676536"
     variation       1640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380677810"
     variation       1641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450281687"
     variation       1648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200386"
     variation       1649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753581178"
     variation       1657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369132344"
     variation       1663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315940344"
     variation       1665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561985082"
     variation       1667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752463508"
     variation       1668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:979196237"
     variation       1670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411146175"
     variation       1674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236316324"
     variation       1675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757836508"
     variation       1678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172950099"
     variation       1682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200528151"
     variation       1692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148904467"
     variation       1693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114762109"
     variation       1696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781769275"
     variation       1705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746211474"
     variation       1708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147619126"
     variation       1710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1241814497"
     variation       1711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421904841"
     variation       1713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1033556936"
     variation       1717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1410675699"
     variation       1719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303839850"
     variation       1721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175638960"
     variation       1722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564223053"
     variation       1727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403935615"
     variation       1728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780133425"
     variation       1730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368410259"
     variation       1732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227270289"
     variation       1733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768766027"
     variation       1745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429753324"
     variation       1747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192159808"
     variation       1753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210835202"
     variation       1755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566315747"
     variation       1756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774452059"
     variation       1760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761904658"
     variation       1761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770836132"
     variation       1766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320750102"
     variation       1769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546635210"
     variation       1770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559696036"
     variation       1771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446995731"
     variation       1772..1801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcacca"
                     /replace="gcaccaccccctcctcttcccaaggcacca"
                     /db_xref="dbSNP:1020613370"
     variation       1773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202141378"
     variation       1775..1776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:776272139"
     variation       1775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765078280"
     variation       1778..1782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:759133015"
     variation       1778
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190786875"
     variation       1779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528658002"
     variation       1780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427508227"
     variation       1781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565245537"
     variation       1782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752444601"
     variation       1791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763681670"
     variation       1792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751028297"
     variation       1796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399973022"
     variation       1797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905028710"
     variation       1803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756875792"
     variation       1805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346694624"
     variation       1809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360885642"
     variation       1812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178325419"
     variation       1821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781755154"
     variation       1822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565245806"
     variation       1824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142141564"
     variation       1825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780400707"
     variation       1828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224830351"
     variation       1832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426922926"
     variation       1833..1834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cg"
                     /db_xref="dbSNP:764501097"
     variation       1833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548635055"
     variation       1834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138675193"
     variation       1839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779053874"
     variation       1845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201967564"
     variation       1846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373604882"
     variation       1847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772211415"
     variation       1850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759414892"
     variation       1851
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375286554"
     variation       1852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868130401"
     variation       1858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200409000"
     variation       1859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1411401726"
     variation       1861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468646591"
     variation       1862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775312857"
     variation       1865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009483361"
     variation       1866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762673854"
     variation       1870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371437428"
     variation       1871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565246362"
     variation       1873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763776508"
     variation       1874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774186572"
     variation       1877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220057312"
     variation       1886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761403864"
     variation       1887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318217606"
     variation       1888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767192455"
     variation       1890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303359837"
     variation       1893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749966059"
     variation       1895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756650921"
     variation       1896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868623666"
     variation       1900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766819530"
     variation       1901
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412781477"
     variation       1902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967703549"
     variation       1903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303372202"
     variation       1906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754208971"
     variation       1909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368976938"
     variation       1910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779196180"
     variation       1912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748429941"
     variation       1920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1223564644"
     variation       1921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758636102"
     variation       1924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436181308"
     variation       1925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777760422"
     variation       1926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747119603"
     variation       1927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769718707"
     variation       1929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761911531"
     variation       1930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565246940"
     variation       1943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775335544"
     variation       1944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7083776"
     variation       1946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768402028"
     variation       1947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141860738"
     variation       1950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761497503"
     variation       1954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434869581"
     variation       1955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766415523"
     variation       1957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:555097355"
     variation       1960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772802074"
     variation       1964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149295961"
     variation       1966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150192288"
     variation       1971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452622441"
     variation       1978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182927465"
     variation       1980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754373092"
     variation       1982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138676514"
     variation       1990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1250989108"
     variation       1993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758516019"
     variation       1996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528483370"
     variation       1997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765465926"
     variation       2000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764011384"
     variation       2001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758575064"
     variation       2003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777989681"
     variation       2006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188032605"
     variation       2007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757318734"
     variation       2011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323309835"
     variation       2014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1372152237"
     variation       2027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460212228"
     variation       2033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142251964"
     variation       2035
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371156233"
     variation       2036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749239930"
     variation       2037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768651010"
     variation       2040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747979426"
     variation       2041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771828660"
     variation       2043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144525982"
     variation       2048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026573145"
     variation       2049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456664972"
     variation       2053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950570245"
     variation       2056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295214997"
     variation       2060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760229129"
     variation       2062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484746783"
     variation       2063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165993129"
     variation       2064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770408995"
     variation       2066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381715116"
     variation       2067..2079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccagctcacactc"
                     /db_xref="dbSNP:774694320"
     variation       2071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776222468"
     variation       2075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759897081"
     variation       2078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261194202"
     variation       2081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462547161"
     variation       2083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535624704"
     variation       2084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896311539"
     variation       2087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489282823"
     variation       2091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113893072"
     variation       2092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964735729"
     variation       2093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426494594"
     variation       2097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763354809"
     variation       2100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764266181"
     variation       2101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751794067"
     variation       2103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757345853"
     variation       2105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311374362"
     variation       2108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408943663"
     variation       2109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467059301"
     variation       2113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288779126"
     variation       2115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:60531929"
     variation       2116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384238466"
     variation       2117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750519794"
     variation       2119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372711396"
     variation       2120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754824553"
     variation       2121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393224247"
     variation       2125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779042725"
     variation       2130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747923514"
     variation       2134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1324359806"
     variation       2135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359122985"
     variation       2136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233942408"
     variation       2137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772061605"
     variation       2143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777557684"
     variation       2144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161001710"
     variation       2150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750786303"
     variation       2157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565248544"
     variation       2161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12246656"
     variation       2162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196194179"
     variation       2163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267690614"
     variation       2165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185645252"
     variation       2166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770626137"
     variation       2171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490064597"
     variation       2173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756674929"
     variation       2175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759104786"
     variation       2180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770259437"
     variation       2187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166423895"
     variation       2188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776015159"
     variation       2189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867958572"
     variation       2192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377480879"
     variation       2194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026545025"
     variation       2195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299114677"
     variation       2196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764499001"
     variation       2197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751965125"
     variation       2198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201122938"
     variation       2199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750449339"
     variation       2201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756303366"
     variation       2203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306226094"
     variation       2204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778991503"
     variation       2205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148637680"
     variation       2209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780554760"
     variation       2210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286552880"
     variation       2211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300479885"
     variation       2212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420821296"
     variation       2213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199569835"
     variation       2215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539975814"
     variation       2216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270547451"
     variation       2219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170290648"
     variation       2224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746855730"
     variation       2232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467133093"
     variation       2233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756807063"
     variation       2234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142091094"
     variation       2243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745336794"
     variation       2245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371118062"
     variation       2246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769357558"
     variation       2250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775962093"
     variation       2251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749736471"
     variation       2252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1165738314"
     variation       2256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254004453"
     variation       2257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769155262"
     variation       2263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774538172"
     variation       2264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762287107"
     variation       2269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296455453"
     variation       2271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767604128"
     variation       2273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448976430"
     variation       2274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773552274"
     variation       2280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760826192"
     variation       2282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401058971"
     variation       2283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766512610"
     variation       2284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753974305"
     variation       2288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758375668"
     variation       2289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321880106"
     variation       2291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764117878"
     variation       2292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249174665"
     variation       2296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751286519"
     variation       2297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528706688"
     variation       2299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151146332"
     variation       2300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745575153"
     variation       2306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1185749198"
     variation       2310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755775293"
     variation       2312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373061354"
     variation       2314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748828410"
     variation       2317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917756850"
     variation       2319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026226062"
     variation       2320..2322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:762431847"
     variation       2322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769102037"
     variation       2323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001743"
     variation       2325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201768336"
     variation       2328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171042722"
     variation       2331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772547313"
     variation       2332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773464003"
     variation       2336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370133969"
     variation       2341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41288002"
     variation       2342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1292960472"
     variation       2346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201927666"
     variation       2349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319428254"
     variation       2353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016075340"
     variation       2356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868288892"
     variation       2358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537115035"
     variation       2366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256931312"
     variation       2370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759735357"
     variation       2371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903795349"
     variation       2375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260237649"
     variation       2384..2386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:35940982"
     variation       2384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996224642"
     variation       2388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201625808"
     variation       2390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561185577"
     variation       2396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756986623"
     variation       2397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475275986"
     variation       2401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356113781"
     variation       2406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767283030"
     variation       2407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889443017"
     variation       2408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421860489"
     variation       2417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570530902"
     variation       2421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341641620"
     variation       2422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755723859"
     variation       2425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779701973"
     variation       2430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533321618"
     variation       2433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754584500"
     variation       2434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327584464"
     variation       2435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370792706"
     variation       2437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359567691"
     variation       2440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546814637"
     variation       2441
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147635960"
     variation       2445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401954590"
     variation       2446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341925893"
     variation       2448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772464828"
     variation       2454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201466757"
     variation       2455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747403207"
     variation       2460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374576101"
     variation       2462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368073870"
     variation       2465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192876235"
     variation       2468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769972131"
     variation       2470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775443867"
     variation       2471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535338058"
     variation       2472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767385508"
     variation       2473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144398174"
     variation       2474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512466"
     variation       2477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026886132"
     variation       2478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174278529"
     variation       2479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569034512"
     variation       2480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309190983"
     variation       2481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569744421"
     variation       2482
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145289539"
     variation       2490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778422472"
     variation       2491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752182627"
     variation       2493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558056061"
     variation       2494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341872"
     variation       2496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437935983"
     variation       2499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751950014"
     variation       2500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350507702"
     variation       2502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149165465"
     variation       2504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1229166880"
     variation       2506..2575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tcatgctggggtgccacatcccccccagggggagaacttggcagcaga
                     cctggggctcacggcactcatc"
                     /replace="tcatgctggggtgccacatcccccccagggggagaacttggcagcaga
                     cctggggctcacggcactcatcatgctggggtgccacatcccccccagggggagaact
                     tggcagcagacctggggctcacggcactcatc"
                     /db_xref="dbSNP:1565251348"
     variation       2509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781548516"
     variation       2513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577728559"
     variation       2515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769911320"
     variation       2523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562599269"
     variation       2525..2531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:750901207"
     variation       2525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762964320"
     variation       2526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277717545"
     variation       2527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867214057"
     variation       2528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199597673"
     variation       2529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773200885"
     variation       2530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370393890"
     variation       2531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048137249"
     variation       2532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145103148"
     variation       2533..2537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:756151149"
     variation       2533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11597437"
     variation       2534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759190818"
     variation       2535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471985798"
     variation       2536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370877791"
     variation       2539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537034175"
     variation       2542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406609251"
     variation       2543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977973379"
     variation       2544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553632378"
     variation       2546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757503632"
     variation       2548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373805946"
     variation       2557..2560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1312059846"
     variation       2557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148302255"
     variation       2558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200640597"
     variation       2559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218202624"
     variation       2560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172333971"
     variation       2563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757850175"
     variation       2565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781633294"
     variation       2566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746247635"
     variation       2567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368496781"
     variation       2568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372856593"
     variation       2572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74901704"
     variation       2575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768782999"
     variation       2577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201169518"
     variation       2580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145909090"
     variation       2581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366494014"
     variation       2582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954899233"
     variation       2589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770888861"
     variation       2590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395195880"
     variation       2595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565252297"
     variation       2596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407673514"
     variation       2600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361153971"
     variation       2604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159916934"
     variation       2606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138475310"
     variation       2607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401590237"
     variation       2610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423270574"
     variation       2612..2615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1174567037"
     variation       2612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452375961"
     variation       2613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147171017"
     variation       2614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764915560"
     variation       2617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245863074"
     variation       2624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775075745"
     variation       2628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489555792"
     variation       2629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264542655"
     variation       2630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337562560"
     variation       2633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762507712"
     variation       2636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259927483"
     variation       2637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968963111"
     variation       2638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763636597"
     variation       2641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746017280"
     variation       2642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150668512"
     variation       2643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768159687"
     variation       2645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750776742"
     variation       2646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958859981"
     variation       2647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274025678"
     variation       2648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372095023"
     variation       2651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476563960"
     variation       2653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345458637"
     variation       2656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172111754"
     variation       2669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756474425"
     variation       2672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10887063"
     variation       2674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335291450"
     variation       2676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887908913"
     variation       2678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404849634"
     variation       2679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396930945"
     variation       2683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749414532"
     variation       2689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778926377"
     variation       2693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564421543"
     variation       2697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770835948"
     variation       2699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776477606"
     variation       2700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745676113"
     variation       2701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377277808"
     variation       2703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775365809"
     variation       2712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762625092"
     variation       2713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368173512"
     variation       2714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773947901"
     variation       2717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761456928"
     variation       2718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768037393"
     variation       2719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750959270"
     variation       2721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761259077"
     variation       2723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766587352"
     variation       2724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379825254"
     variation       2727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140280635"
     variation       2729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244079867"
     variation       2730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210280761"
     variation       2731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142075625"
     variation       2732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779158034"
     variation       2735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752746017"
     variation       2739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758543512"
     variation       2740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781180184"
     variation       2742..2745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:766506682"
     variation       2746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149275566"
     variation       2749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371996281"
     variation       2752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047409790"
     variation       2754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779670767"
     variation       2757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529398984"
     variation       2764..2765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:747873325"
     variation       2764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376114582"
     variation       2767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774186447"
     variation       2769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381326737"
     variation       2782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286029248"
     variation       2783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490048887"
     variation       2784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761403994"
     variation       2791..2792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tttg"
                     /db_xref="dbSNP:754168852"
     variation       2793..2794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:755243171"
     variation       2799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270100081"
     variation       2803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771425196"
     variation       2804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772782385"
     variation       2807
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197805195"
     variation       2809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144481289"
     variation       2812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151325176"
     variation       2814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355443115"
     variation       2816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159498466"
     variation       2823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569094533"
     variation       2824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456461298"
     variation       2834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565254036"
     variation       2835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037615068"
     variation       2839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41288004"
     variation       2841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183592859"
     variation       2842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261968519"
     variation       2846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996005967"
     variation       2848
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765438006"
     variation       2850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369401230"
     variation       2853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759349202"
     variation       2855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241981531"
     variation       2859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565254265"
     variation       2860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371747734"
     variation       2861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358197808"
     variation       2866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375029779"
     variation       2870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751695214"
     variation       2876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323367095"
     variation       2877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488505476"
     variation       2879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369006789"
     variation       2884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780090188"
     variation       2890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441945248"
     variation       2891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179579358"
     variation       2900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639717"
     variation       2904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422347239"
     variation       2907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558111165"
     variation       2911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565254553"
     variation       2917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376290288"
     variation       2922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307223842"
     variation       2926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350579736"
     variation       2928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449245390"
     variation       2929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461510287"
     variation       2938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747735733"
     variation       2944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571515128"
     variation       2945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772546309"
     variation       2947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309792473"
     variation       2948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771308641"
     variation       2953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777186376"
     variation       2961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048579150"
     variation       2963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377924349"
     variation       2965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759877044"
     variation       2968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020247194"
     variation       2982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533590866"
     variation       2983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765524349"
     variation       2984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117734649"
     variation       2994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573509371"
     variation       2995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751566772"
     variation       2996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751571229"
     variation       3000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489355712"
     variation       3001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265915063"
     variation       3003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140606887"
     variation       3007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183848172"
     variation       3009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351481349"
     variation       3013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025016213"
     variation       3016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283952053"
     variation       3019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428005203"
     variation       3020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168535545"
     variation       3022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766415831"
     variation       3026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142194146"
     variation       3027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331920239"
     variation       3031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999620785"
     variation       3035
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151198040"
     variation       3036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747977383"
     variation       3041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304184250"
     variation       3043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774454610"
     variation       3044
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777520041"
     variation       3045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024869016"
     variation       3051
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353645806"
     variation       3054..3127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ag"
                     /replace="agtcctcgagggtctcgcctccagcagcagatgtcttaaaagactttt
                     ctcttgcagggaacttcagcagaaag"
                     /db_xref="dbSNP:1565255515"
     variation       3054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970505269"
     variation       3055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746493115"
     variation       3060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275823352"
     variation       3061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373322084"
     variation       3063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112188313"
     variation       3064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278485981"
     variation       3065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376454944"
     variation       3068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212614772"
     variation       3069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770320810"
     variation       3070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149803621"
     variation       3072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191759613"
     variation       3074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973342664"
     variation       3075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567308602"
     variation       3077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265484100"
     variation       3082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231310372"
     variation       3084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764193740"
     variation       3087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171330269"
     variation       3095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424310114"
     variation       3096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774703041"
     variation       3097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931864180"
     variation       3098..3101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1178047854"
     variation       3099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767648184"
     variation       3102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1399066665"
     variation       3105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051623851"
     variation       3111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341866497"
     variation       3112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750562778"
     variation       3113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300617331"
     variation       3115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274789510"
     variation       3121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145748763"
     variation       3122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765313097"
     variation       3127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171043621"
     variation       3130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1279848159"
     variation       3143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140641088"
     variation       3146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758278410"
     variation       3147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457489734"
     variation       3148..3151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1288371627"
     variation       3149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488668121"
     variation       3150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777275006"
     variation       3153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245051891"
     variation       3157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477034011"
     variation       3158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:904553223"
     variation       3159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746610603"
     variation       3162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756903499"
     variation       3166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780242938"
     variation       3167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1034283140"
     variation       3171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369386229"
     variation       3175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361997969"
     variation       3178
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419777555"
     variation       3183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754393114"
     variation       3187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318279705"
     variation       3194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776019343"
     variation       3195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749612529"
     variation       3198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531738196"
     variation       3201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533671771"
     variation       3204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762054534"
     variation       3205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540533028"
     variation       3206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354777334"
     variation       3208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773402221"
     variation       3211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364273844"
     variation       3212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435639179"
     variation       3213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1287880074"
     variation       3214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264008470"
     variation       3215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150064065"
     variation       3220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316483501"
     variation       3225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765258038"
     variation       3228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253492659"
     variation       3233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115790843"
     variation       3236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902532640"
     variation       3248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999906345"
     variation       3249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762808866"
     variation       3250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162257930"
     variation       3252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014664526"
     variation       3255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963069615"
     variation       3256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406554177"
     variation       3258..3261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:778887227"
     variation       3259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751345990"
     variation       3260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445209818"
     variation       3262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:893907659"
     variation       3265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378087580"
     variation       3271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756858369"
     variation       3273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282606971"
     variation       3274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780875270"
     variation       3276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228901996"
     variation       3284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753073"
     variation       3288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457310713"
     variation       3289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375580409"
     variation       3294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239830123"
     variation       3297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780412768"
     variation       3298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762157882"
     variation       3299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562955567"
     variation       3301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473497381"
     variation       3303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165099565"
     variation       3305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769048028"
     variation       3308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779288189"
     variation       3312..3315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="cccc"
                     /db_xref="dbSNP:747878043"
     variation       3312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748510179"
     variation       3313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366653303"
     variation       3317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267826947"
     variation       3318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143377886"
     variation       3325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773633306"
     variation       3326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342415729"
     variation       3330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760822277"
     variation       3339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201895792"
     variation       3341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565257724"
     variation       3345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277711233"
     variation       3352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200089998"
     variation       3357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316120571"
     variation       3364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216763677"
     variation       3365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771074320"
     variation       3366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339848997"
     variation       3369
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776575219"
     variation       3370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253813524"
     variation       3375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762904530"
     variation       3376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936063133"
     variation       3377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261892627"
     variation       3379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763964610"
     variation       3380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11200387"
     variation       3386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307948299"
     variation       3388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373281844"
     variation       3389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377162544"
     variation       3396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767703999"
     variation       3398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171256609"
     variation       3403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750135495"
     variation       3406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755777292"
     variation       3409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779550947"
     variation       3411..3414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1329222322"
     variation       3413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753310888"
     variation       3415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401867935"
     variation       3416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388431014"
     variation       3419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280024053"
     variation       3421..3424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:758166315"
     variation       3422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755488831"
     variation       3428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951314455"
     variation       3433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254082078"
     variation       3439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779326266"
     variation       3440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385921928"
     variation       3443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748517134"
     variation       3448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:547344614"
     variation       3451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747157686"
     variation       3452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178167076"
     variation       3455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438054962"
     variation       3458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046402183"
     variation       3459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887306452"
     variation       3465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771085934"
     variation       3466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1261805424"
     variation       3468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776727702"
     variation       3469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745988155"
     variation       3470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197343035"
     variation       3471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768609936"
     variation       3472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41288006"
     variation       3473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761583861"
     variation       3474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199691186"
     variation       3475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772996349"
     variation       3477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937118499"
     variation       3478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746589548"
     variation       3481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289579921"
     variation       3483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58421538"
     variation       3484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753356833"
     variation       3491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7073433"
     variation       3492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765760444"
     variation       3499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953156616"
     variation       3501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753194129"
     variation       3502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143465172"
     variation       3505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778239169"
     variation       3506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374246191"
     variation       3512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1046697933"
     variation       3514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210936430"
     variation       3517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1260850232"
     variation       3518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757482922"
     variation       3519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781313118"
     variation       3530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254677297"
     variation       3531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745958023"
     variation       3536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270033021"
     variation       3537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769825628"
     variation       3542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:967290744"
     variation       3544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775561709"
     variation       3545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147140774"
     variation       3547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378842106"
     variation       3548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977241449"
     variation       3550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441829059"
     variation       3552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925749060"
     variation       3554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748012977"
     variation       3557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477845250"
     variation       3558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201283222"
     variation       3562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772967952"
     variation       3565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140254775"
     variation       3566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377358487"
     variation       3568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471657765"
     variation       3569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370359361"
     variation       3575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759236435"
     variation       3589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764582325"
     variation       3590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200785553"
     variation       3593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307214920"
     variation       3597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218259462"
     variation       3598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758923315"
     variation       3599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764750855"
     variation       3600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751945438"
     variation       3602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566377148"
     variation       3607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776235670"
     variation       3609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198546831"
     variation       3621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236776851"
     variation       3624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141360696"
     variation       3625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145035433"
     variation       3627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756365382"
     variation       3629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780069470"
     variation       3632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167084166"
     variation       3633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418645005"
     variation       3641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461935934"
     variation       3642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138892486"
     variation       3651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368649119"
     variation       3652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958360797"
     variation       3658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777754404"
     variation       3659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898633554"
     variation       3663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372405430"
     variation       3665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867711974"
     variation       3670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770572757"
     variation       3674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294650888"
     variation       3675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776487415"
     variation       3677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759068587"
     variation       3685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560590906"
     variation       3687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320462719"
     variation       3688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775114861"
     variation       3689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762596354"
     variation       3692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764697787"
     variation       3694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574013647"
     variation       3697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543039628"
     variation       3698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477513653"
     variation       3699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750833650"
     variation       3704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1421316772"
     variation       3707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476704358"
     variation       3711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411452249"
     variation       3713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563010428"
     variation       3716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780294751"
     variation       3717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1565260344"
     variation       3717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531851854"
     variation       3719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755107116"
     variation       3726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778975786"
     variation       3732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61756213"
     variation       3733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306914341"
     variation       3734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350703229"
     variation       3735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971124190"
     variation       3742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148462201"
     variation       3743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276863653"
     variation       3745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008991896"
     variation       3747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766394403"
     variation       3749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374367001"
     variation       3754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215651323"
     variation       3757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780796802"
     variation       3758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367931147"
     variation       3760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769543302"
     variation       3766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142607481"
     variation       3770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369885153"
     variation       3771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565260715"
     variation       3772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488011536"
     variation       3774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214458563"
     variation       3775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265420094"
     variation       3780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270778148"
     variation       3783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447410451"
     variation       3784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768227014"
     variation       3786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548512736"
     variation       3787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:777605657"
     variation       3791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371617188"
     variation       3792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054002665"
     variation       3802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175145407"
     variation       3805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762187942"
     variation       3806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400001164"
     variation       3809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418714196"
     variation       3810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1295868539"
     variation       3818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168855098"
     variation       3819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768092599"
     variation       3821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432154804"
     variation       3823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750732161"
     variation       3824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761093325"
     variation       3825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753999926"
     variation       3828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146828853"
     variation       3833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374980249"
     variation       3834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991612701"
     variation       3835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238220937"
     variation       3839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286480068"
     variation       3841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457079141"
     variation       3842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139627182"
     variation       3849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757115668"
     variation       3850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527457428"
     variation       3863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781226978"
     variation       3866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189702146"
     variation       3872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289090553"
     variation       3875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227774437"
     variation       3879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745649340"
     variation       3880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756035009"
     variation       3881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046167542"
     variation       3883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780010998"
     variation       3886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908501483"
     variation       3889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432408089"
     variation       3890..3897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ccttacct"
                     /db_xref="dbSNP:1400731544"
     variation       3890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323492044"
     variation       3898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348578371"
     variation       3899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453643537"
     variation       3904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748886768"
     variation       3905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368826592"
     variation       3907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570203372"
     variation       3908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238286947"
     variation       3910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772452609"
     variation       3916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773826102"
     variation       3917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547702577"
     variation       3921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423336814"
     variation       3922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144252123"
     variation       3923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332665353"
     variation       3924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549308243"
     variation       3926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867691226"
     variation       3928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253433266"
     variation       3941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777008551"
     variation       3943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759701337"
     variation       3945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234196865"
     variation       3947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765543263"
     variation       3949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752685625"
     variation       3950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758573870"
     variation       3957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463512860"
     variation       3958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146552537"
     variation       3959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178675975"
     variation       3964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400059184"
     variation       3965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443838890"
     variation       3966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750322048"
     variation       3967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932790809"
     variation       3970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756129607"
     variation       3976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361579585"
     variation       3979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189703796"
     variation       3980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141191344"
     variation       3984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778669774"
     variation       3988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305156438"
     variation       3989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387737473"
     variation       3993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357409799"
     variation       3995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140508731"
     variation       3997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375356735"
     variation       4001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867158937"
     variation       4004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273678963"
     variation       4006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317079427"
     variation       4008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771550397"
     variation       4010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274850801"
     variation       4014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438103579"
     variation       4017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186372970"
     variation       4018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757619080"
     variation       4025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475874537"
     variation       4026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145858416"
     variation       4029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160800878"
     variation       4031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747473505"
     variation       4032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771446927"
     variation       4034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201269542"
     variation       4038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1424186719"
     variation       4040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759931970"
     variation       4046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414163684"
     variation       4051
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332385929"
     variation       4057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368864486"
     variation       4058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371332642"
     variation       4059..4064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1565262628"
     variation       4059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763099889"
     variation       4060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293834161"
     variation       4061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764172737"
     variation       4062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225136693"
     variation       4063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148992015"
     variation       4065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766468837"
     variation       4066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1106992"
     variation       4067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200389636"
     variation       4074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754870626"
     variation       4075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583843"
     variation       4077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211066156"
     variation       4080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347887090"
     variation       4083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032873351"
     variation       4090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752326690"
     variation       4091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866265498"
     variation       4096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138440519"
     variation       4101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195920400"
     variation       4102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777284379"
     variation       4106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77722854"
     variation       4110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565263029"
     variation       4111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172019785"
     variation       4116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290174956"
     variation       4122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578136211"
     variation       4124..4126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:746900532"
     variation       4124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746220751"
     variation       4130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145835442"
     variation       4131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763198415"
     variation       4135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320152000"
     variation       4137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990151098"
     variation       4145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143678523"
     variation       4147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774550802"
     variation       4148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762026579"
     variation       4149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766415869"
     variation       4152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754121824"
     variation       4158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259728976"
     variation       4159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207040450"
     variation       4161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284744082"
     variation       4162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484586855"
     variation       4163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565263457"
     variation       4164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753769021"
     variation       4165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199771319"
     variation       4169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759394267"
     variation       4175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574376849"
     variation       4176
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908580173"
     variation       4182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397253374"
     variation       4193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755573981"
     variation       4202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1218546185"
     variation       4203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158239667"
     variation       4205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752456833"
     variation       4206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348904647"
     variation       4208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940003180"
     variation       4210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1325271548"
     variation       4213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297011162"
     variation       4217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777439307"
     variation       4219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2420984"
     variation       4225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160232595"
     variation       4228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385667245"
     variation       4229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141137444"
     variation       4231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756815559"
     variation       4235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372874231"
     variation       4239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201403636"
     variation       4242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746310341"
     variation       4247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314623696"
     variation       4252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2420985"
     variation       4262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240476299"
     variation       4263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260795730"
     variation       4264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356331011"
     variation       4268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150806548"
     variation       4269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2420986"
     variation       4270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047104634"
     variation       4274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562873954"
     variation       4276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2901300"
     variation       4278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768892142"
     variation       4282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774783738"
     variation       4285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761973358"
     variation       4289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772210885"
     variation       4292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773457153"
     variation       4299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139193688"
     variation       4302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149524584"
     variation       4303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146003266"
     variation       4304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242652108"
     variation       4307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139901847"
     variation       4309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375410376"
     variation       4312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370022515"
     variation       4317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766977575"
     variation       4323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:906834461"
     variation       4331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999028066"
     variation       4341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749926931"
     variation       4348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753074"
     variation       4352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373598465"
     variation       4359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148089397"
     variation       4361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73370132"
     variation       4376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198489283"
     variation       4377..4379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1383160609"
     variation       4378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142268660"
     variation       4380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748339041"
     variation       4381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753197990"
     variation       4382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565264695"
     variation       4384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:561278421"
     variation       4386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747095730"
     variation       4390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168394869"
     variation       4391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529950167"
     variation       4397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775345822"
     variation       4399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762957952"
     variation       4410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012797762"
     variation       4414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763813576"
     variation       4415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565264873"
     variation       4418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446598277"
     variation       4420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549620504"
     variation       4421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201709460"
     variation       4426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253159637"
     variation       4431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767210325"
     variation       4432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186111089"
     variation       4433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766896829"
     variation       4445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754242356"
     variation       4447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755571334"
     variation       4448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214475865"
     variation       4449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151338600"
     variation       4451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756835346"
     variation       4453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359637058"
     variation       4456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278614134"
     variation       4457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4752642"
     variation       4461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758659101"
     variation       4463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255573458"
     variation       4476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777920896"
     variation       4478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747095409"
     variation       4480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369857658"
     variation       4484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386136050"
     variation       4490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776779050"
     variation       4491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749187326"
     variation       4494..4511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ca"
                     /replace="cagtgggtaaagacctca"
                     /db_xref="dbSNP:770443389"
     variation       4494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430031081"
     variation       4495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166667485"
     variation       4497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768607283"
     variation       4508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394172349"
     variation       4510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301305433"
     variation       4512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432466986"
     variation       4513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774114513"
     variation       4516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147103470"
     variation       4517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430685678"
     variation       4519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199708536"
     variation       4520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147723400"
     variation       4523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772799623"
     variation       4529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867470186"
     variation       4531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745640843"
     variation       4534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765765099"
     variation       4537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346058715"
     variation       4538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347443826"
     variation       4550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236740359"
     variation       4564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554079517"
     variation       4567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948626847"
     variation       4568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760096865"
     variation       4573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765884417"
     variation       4574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752256733"
     variation       4578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758887730"
     variation       4580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567812975"
     variation       4582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224010366"
     variation       4583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372773858"
     variation       4586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283002232"
     variation       4589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757532639"
     variation       4590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142508761"
     variation       4592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1352479260"
     variation       4592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745999458"
     variation       4602..4609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:1399558971"
     variation       4605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157568359"
     variation       4609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031734588"
     variation       4613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145895228"
     variation       4625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778889567"
     variation       4628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747926543"
     variation       4631
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369192418"
     variation       4633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443418196"
     variation       4638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771707264"
     variation       4640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773065628"
     variation       4646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760195137"
     variation       4647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138712565"
     variation       4649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775971633"
     variation       4650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377557246"
     variation       4652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765823262"
     variation       4654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4751871"
     variation       4655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201384640"
     variation       4657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143443054"
     variation       4658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751979400"
     variation       4659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7920896"
     variation       4665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781520600"
     variation       4666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750498409"
     variation       4672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164787944"
     variation       4673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236328663"
     variation       4676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756245611"
     variation       4677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463290783"
     variation       4684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780122291"
     variation       4688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748013331"
     variation       4690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054052519"
     variation       4693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777406394"
     variation       4695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746859836"
     variation       4697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374096374"
     variation       4700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770484899"
     variation       4701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776476408"
     variation       4703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201773248"
     variation       4704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141796592"
     variation       4705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290319071"
     variation       4708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436918556"
     variation       4711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201971567"
     variation       4712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763323058"
     variation       4713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764713772"
     variation       4716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907056248"
     variation       4718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774552350"
     variation       4719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762309480"
     variation       4720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146023378"
     variation       4721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750586655"
     variation       4726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756335605"
     variation       4729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408461199"
     variation       4737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753966616"
     variation       4741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355196565"
     variation       4743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556256653"
     variation       4744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908534813"
     variation       4747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291502888"
     variation       4752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777833001"
     variation       4755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746766875"
     variation       4757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139933944"
     variation       4759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781135664"
     variation       4761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745475032"
     variation       4762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769594745"
     variation       4764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775121013"
     variation       4768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374990835"
     variation       4769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769043605"
     variation       4772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995555590"
     variation       4773..4774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:763510151"
     variation       4775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254746211"
     variation       4778
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774980994"
     variation       4782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188803824"
     variation       4785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372890834"
     variation       4791..4802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cagcctggccag"
                     /replace="cagcctggccagcctggccag"
                     /db_xref="dbSNP:776107296"
     variation       4791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77105181"
     variation       4793..4814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcc"
                     /replace="gcctggccaggcctggaaggcc"
                     /db_xref="dbSNP:1419438243"
     variation       4794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767804940"
     variation       4798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476124663"
     variation       4800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146103943"
     variation       4802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766627580"
     variation       4804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565267535"
     variation       4806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753857053"
     variation       4807
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139774351"
     variation       4814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182569065"
     variation       4815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334686941"
     variation       4818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765242232"
     variation       4819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751443504"
     variation       4822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1359762986"
     variation       4824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757170587"
     variation       4829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781082579"
     variation       4831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866903091"
     variation       4832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745709267"
     variation       4834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755799027"
     variation       4836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277611573"
     variation       4837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349352760"
     variation       4838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779920795"
     variation       4842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204067284"
     variation       4843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978249761"
     variation       4847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602391"
     variation       4853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195847316"
     variation       4855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249015665"
     variation       4859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231212957"
     variation       4862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454032760"
     variation       4867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748735038"
     variation       4869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768158400"
     variation       4871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306298193"
     variation       4872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141300976"
     variation       4873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1173096798"
     variation       4878
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748652112"
     variation       4882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380445959"
     variation       4883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773532416"
     variation       4888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761091161"
     variation       4893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439735004"
     variation       4902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300731857"
     variation       4903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771124301"
     variation       4906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565268191"
     variation       4907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233421657"
     variation       4911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144683166"
     variation       4915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377713529"
     variation       4919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934420612"
     variation       4928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765318801"
     variation       4929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269200737"
     variation       4930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380859050"
     variation       4932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543590504"
     variation       4936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752740775"
     variation       4941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200004584"
     variation       4942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052820093"
     variation       4944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054127152"
     variation       4946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767605167"
     variation       4948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543328111"
     variation       4949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77475605"
     variation       4953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200979254"
     variation       4957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1451583365"
     variation       4961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754620520"
     variation       4962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217362839"
     variation       4967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375588375"
     variation       4969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649758"
     variation       4974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323638092"
     variation       4977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560162"
     variation       4978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778307131"
     variation       4979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747524473"
     variation       4981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333441263"
     variation       4984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241838025"
     variation       4985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289465351"
     variation       4989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368266470"
     variation       4998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900024723"
     variation       4999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776890649"
     variation       5002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002749520"
     variation       5003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372471760"
     variation       5007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769956931"
     variation       5009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195403704"
     variation       5012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248537428"
     variation       5013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148498917"
     variation       5014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763193413"
     variation       5015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199669973"
     variation       5021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412699462"
     variation       5022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211980"
     variation       5025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150804431"
     variation       5028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482522779"
     variation       5029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11599291"
     variation       5030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199665884"
     variation       5033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111241981"
     variation       5041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368179089"
     variation       5044
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200645473"
     variation       5050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556922327"
     variation       5051
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777266081"
     variation       5053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371295390"
     variation       5055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020010097"
     variation       5058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544094906"
     variation       5059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199785683"
     variation       5062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322645991"
     variation       5064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781596141"
     variation       5065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746260034"
     variation       5070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770052058"
     variation       5076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180675951"
     variation       5077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749535629"
     variation       5081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485324981"
     variation       5082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294100754"
     variation       5085
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768793077"
     variation       5093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201869943"
     variation       5096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760644346"
     variation       5098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169319366"
     variation       5099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866334081"
     variation       5100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766278349"
     variation       5101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916025093"
     variation       5106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202019397"
     variation       5110..5113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1413495846"
     variation       5115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989883649"
     variation       5123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147738883"
     variation       5124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380355451"
     variation       5127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75029377"
     variation       5129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765089820"
     variation       5133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866837240"
     variation       5141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981312019"
     variation       5144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293861577"
     variation       5146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368771136"
     variation       5148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758076925"
     variation       5149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200150846"
     variation       5153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751117812"
     variation       5155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757749357"
     variation       5157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781617648"
     variation       5158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160958106"
     variation       5159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746232229"
     variation       5160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472813513"
     variation       5163..5164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1555016395"
     variation       5164..5165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gtgaa"
                     /db_xref="dbSNP:745587557"
     variation       5164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565270027"
     variation       5164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="ggtgaaagtg"
                     /db_xref="dbSNP:1428381008"
     variation       5166..5167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgac"
                     /db_xref="dbSNP:769406458"
     variation       5166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372221128"
     variation       5168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756376309"
     variation       5169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450988527"
     variation       5170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142571035"
     variation       5171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144811256"
     variation       5172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432249770"
     variation       5175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177597442"
     variation       5183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151181216"
     variation       5184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453644337"
     variation       5185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376774303"
     variation       5192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774554714"
     variation       5197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436123022"
     variation       5198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748281753"
     variation       5199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140209193"
     variation       5205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150315044"
     variation       5209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931120775"
     variation       5210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137931842"
     variation       5212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565270503"
     variation       5215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369479336"
     variation       5224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138082360"
     variation       5225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775285828"
     variation       5229..5236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cacca"
                     /replace="caccacca"
                     /db_xref="dbSNP:775159083"
     variation       5229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762572247"
     variation       5230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374266799"
     variation       5231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995530793"
     variation       5232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751066749"
     variation       5240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192474180"
     variation       5247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756776332"
     variation       5250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376809823"
     variation       5251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750828385"
     variation       5258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756680474"
     variation       5259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780520493"
     variation       5261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755222761"
     variation       5263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428031738"
     variation       5266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392632922"
     variation       5267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779332914"
     variation       5270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190731334"
     variation       5274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465562338"
     variation       5275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748413057"
     variation       5276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143666237"
     variation       5279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138754206"
     variation       5284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141796876"
     variation       5285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560783379"
     variation       5289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762801574"
     variation       5292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768285955"
     variation       5298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1227393008"
     variation       5299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272284472"
     variation       5313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295343423"
     variation       5319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200641398"
     variation       5322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031208223"
     variation       5324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773937174"
     variation       5330..5334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:762114377"
     variation       5331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761531246"
     variation       5336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988756335"
     variation       5338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995091"
     variation       5340..5345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gt"
                     /replace="gtgcgt"
                     /db_xref="dbSNP:1297167918"
     variation       5341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766898906"
     variation       5343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546030508"
     variation       5344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1565271574"
     variation       5344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164719489"
     variation       5347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116907408"
     variation       5348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753286281"
     variation       5352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324394874"
     variation       5356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754253084"
     variation       5357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755333219"
     variation       5359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309919536"
     variation       5363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528054480"
     variation       5374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752818434"
     variation       5379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933078892"
     variation       5380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758665794"
     variation       5381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777691521"
     variation       5383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747152605"
     variation       5386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769712352"
     variation       5387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749238677"
     variation       5390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774233662"
     variation       5391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779970534"
     variation       5393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253321445"
     variation       5397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444456360"
     variation       5398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200419452"
     variation       5399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187809613"
     variation       5400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771810058"
     variation       5401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772568688"
     variation       5415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760302647"
     variation       5418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746787282"
     variation       5419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969849286"
     variation       5426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760147773"
     variation       5428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980247617"
     variation       5430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276066462"
     variation       5431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:928345161"
     variation       5432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371194782"
     variation       5433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758921659"
     variation       5436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765645451"
     variation       5437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312134244"
     variation       5439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338494040"
     variation       5441
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148022903"
     variation       5443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995750903"
     variation       5447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022979827"
     variation       5449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758517700"
     variation       5451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764442622"
     variation       5452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548012482"
     variation       5454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002974128"
     variation       5456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757271399"
     variation       5458..5459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1210815864"
     variation       5461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918515169"
     variation       5465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956135133"
     variation       5466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444621227"
     variation       5468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188741221"
     variation       5469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365079685"
     variation       5471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241859943"
     variation       5473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561741785"
     variation       5476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749183444"
     variation       5477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390878349"
     variation       5478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434105447"
     variation       5487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754931537"
     variation       5490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778553198"
     variation       5495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748018931"
     variation       5497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771621338"
     variation       5498..5501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1417788599"
     variation       5498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772979275"
     variation       5507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165939944"
     variation       5512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432477123"
     variation       5513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746661006"
     variation       5523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365302633"
     variation       5524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10788237"
     variation       5527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550387151"
     variation       5528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760094555"
     variation       5530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289024778"
     variation       5531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369320771"
     variation       5532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763431049"
     variation       5533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764378043"
     variation       5536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751738477"
     variation       5539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570225185"
     variation       5540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371867918"
     variation       5541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453984019"
     variation       5546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767537356"
     variation       5547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865868863"
     variation       5548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754883354"
     variation       5549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404307778"
     variation       5554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974597241"
     variation       5558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778978597"
     variation       5560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747884557"
     variation       5562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455386109"
     variation       5563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758141860"
     variation       5564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777458270"
     variation       5566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746607621"
     variation       5568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391736896"
     variation       5571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158306556"
     variation       5574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770753371"
     variation       5581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452127900"
     variation       5582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298596702"
     variation       5583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332267749"
     variation       5587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773442499"
     variation       5588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199828025"
     variation       5590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183510976"
     variation       5594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480430073"
     variation       5596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372170043"
     variation       5597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776005771"
     variation       5601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763376130"
     variation       5602..5603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tttttt"
                     /db_xref="dbSNP:1468240223"
     variation       5602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565273580"
     variation       5605..5606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1208252788"
     variation       5605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269586490"
     variation       5607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452193932"
     variation       5609..5612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="caac"
                     /db_xref="dbSNP:1199498594"
     variation       5615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751080448"
     variation       5616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471555540"
     variation       5617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764481500"
     variation       5619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268591751"
     variation       5620..5623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tcca"
                     /db_xref="dbSNP:1412383344"
     variation       5621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147160195"
     variation       5623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1338194433"
     variation       5625..5626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1291367775"
     variation       5626..5627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1392263758"
     variation       5630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762000937"
     variation       5632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306861270"
     variation       5633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349239193"
     variation       5636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376248779"
     variation       5639..5644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ga"
                     /replace="gacaga"
                     /db_xref="dbSNP:1331861033"
     variation       5642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1317871693"
     variation       5642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760804922"
     variation       5651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412254309"
     variation       5652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309108496"
     variation       5656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378910055"
     variation       5659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394724212"
     variation       5660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984093274"
     variation       5662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315259638"
     variation       5664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429659366"
     variation       5668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376075858"
     variation       5669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760835902"
     variation       5670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161105358"
     variation       5673..5677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tacct"
                     /replace="tacctacct"
                     /db_xref="dbSNP:1457646127"
     variation       5676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1471761519"
     variation       5679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766430639"
     variation       5680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563753676"
     variation       5681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762912856"
     variation       5684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764003429"
     variation       5692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751385080"
     variation       5693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179951126"
     variation       5694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191981810"
     variation       5696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976991720"
     variation       5697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954821404"
     variation       5699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187493690"
     variation       5702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387797360"
     variation       5703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008778698"
     variation       5705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370448226"
     variation       5706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781137814"
     variation       5708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139266734"
     variation       5709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464955271"
     variation       5710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755745408"
     variation       5715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779595950"
     variation       5719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748790404"
     variation       5722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356961017"
     variation       5725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769204792"
     variation       5730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779457735"
     variation       5734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229299286"
     variation       5738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973574478"
     variation       5739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311575558"
     variation       5742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748671437"
     variation       5743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373310579"
     variation       5744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483424275"
     variation       5747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773585574"
     variation       5748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749273199"
     variation       5756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201272664"
     variation       5762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215713065"
     variation       5764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778199158"
     variation       5766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249483062"
     variation       5770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747563042"
     variation       5774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893970982"
     variation       5776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757494792"
     variation       5777..5782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="atc"
                     /replace="atcatc"
                     /db_xref="dbSNP:1419489454"
     variation       5782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565392599"
     variation       5783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396135826"
     variation       5784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781643198"
     variation       5787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229634950"
     variation       5788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545751147"
     variation       5789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199955284"
     variation       5793..5797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1203641585"
     variation       5793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775681531"
     variation       5794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759031271"
     variation       5797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374068486"
     variation       5798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772123235"
     variation       5800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254753477"
     variation       5801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772966997"
     variation       5809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1042906107"
     variation       5812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145341685"
     variation       5813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770595283"
     variation       5816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776535002"
     variation       5817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759153407"
     variation       5820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764934219"
     variation       5823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372384478"
     variation       5825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560859062"
     variation       5826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762389768"
     variation       5827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763662132"
     variation       5830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357162289"
     variation       5832..5833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:761248045"
     variation       5834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751970211"
     variation       5837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364004763"
     variation       5838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416902470"
     variation       5839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757804259"
     variation       5840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750857540"
     variation       5841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014587081"
     variation       5843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:766629490"
     variation       5845..5855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgttgttggcc"
                     /db_xref="dbSNP:755296347"
     variation       5845..5852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgttg"
                     /replace="tgttgttg"
                     /db_xref="dbSNP:753935010"
     variation       5847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201242530"
     variation       5849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276961485"
     variation       5855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444420674"
     variation       5856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147336554"
     variation       5857..5858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:765583276"
     variation       5858..5859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aaagaaagaaagatctacaaaggtttctaaacacttacttgaggtt"
                     /db_xref="dbSNP:1565393487"
     variation       5858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367601425"
     variation       5859..5875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tctctacggatctgata"
                     /db_xref="dbSNP:1565393533"
     variation       5859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749537807"
     variation       5860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769340180"
     variation       5862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779085099"
     variation       5865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141016456"
     variation       5866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114501786"
     variation       5867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382200"
     variation       5868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769587453"
     variation       5869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481459939"
     variation       5870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399803331"
     variation       5876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056069"
     variation       5877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762623543"
     variation       5880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144877654"
     variation       5883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762196038"
     variation       5884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749174067"
     variation       5886..5889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tc"
                     /replace="tctc"
                     /db_xref="dbSNP:1169179342"
     variation       5889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768181228"
     variation       5897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414490769"
     variation       5907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200169711"
     variation       5908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565889394"
     variation       5909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364062338"
     variation       5913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231310621"
     variation       5915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767055639"
     variation       5920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895950254"
     variation       5921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534481630"
     variation       5922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377123555"
     variation       5923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145822203"
     variation       5926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923046"
     variation       5930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12765679"
     variation       5933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220747870"
     variation       5934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393560870"
     variation       5936..5938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:777569322"
     variation       5936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340142931"
     variation       5939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442203613"
     variation       5940..5942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:746979348"
     variation       5943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369648685"
     variation       5944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751678488"
     variation       5946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142578469"
     variation       5947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780024892"
     variation       5948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273901341"
     variation       5954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753733864"
     variation       5955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754737818"
     variation       5958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280849029"
     variation       5961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778606346"
     variation       5967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422902389"
     variation       5968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184882845"
     variation       5969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770450758"
     variation       5971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556529935"
     variation       5975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444788385"
     variation       5979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344502759"
     variation       5980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167402538"
     variation       5981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369298895"
     variation       5982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191364618"
     variation       5984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426135207"
     variation       5985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770573957"
     variation       5986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350304247"
     variation       5989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964403375"
     variation       5993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394526091"
     variation       5995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150954247"
     variation       5996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759990714"
     variation       6000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140845862"
     variation       6001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775765147"
     variation       6003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373555551"
     variation       6004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182296008"
     variation       6008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251685959"
     variation       6013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988631023"
     variation       6017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197580486"
     variation       6020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016069820"
     variation       6021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432253871"
     variation       6024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262650274"
     variation       6029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:936331518"
     variation       6030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484924498"
     variation       6036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282896405"
     variation       6038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182555345"
     variation       6049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916316787"
     variation       6053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144152599"
     variation       6054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212664801"
     variation       6061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1267920371"
     variation       6071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185278480"
     variation       6073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535542739"
     variation       6075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770826772"
     variation       6077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348302491"
     variation       6079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751958981"
     variation       6087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233350702"
     variation       6088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923713409"
     variation       6096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940917496"
ORIGIN      
agtgctgaaaaggagcctctggaagagagggccttctcccgcttctctcctcctcctctccacgctggggggatcctggtcacctctgacaaaattctggggacgctgggaacactgaatcaacatgggcaatgagaacagcacctcggacaaccagcaggaggactccgtcttgcataacgtcattctgtggcctccaaaccctgagcccacacagaggactttatcagctcagactccaaggtccgcgcagccacccgggaacagtcagaatataaaaaggaagcagcaggacacgcccggaagccctgaccacagagacgcgtccagcattggcagcgttgggcttggaggcttctgcaccgcttctgagagttctgccagcctggatccatgccttgtgtccccagaggtgactgagccaaggaaggacccacagggagccagggggccagaaggttctttgctgcccagcccaccaccgtcccaggagcgagagcacccctcgtcctccatgccctttgccgagtgtcccccggaaggttgcttggcaagtccagcagcggcacctgaagatggtcctcagactcagtctcccaggagggaacctgccccaaatgccccaggagacatcgcggcggcatttcccgctgagagggacagctctactccataccaagagattgctgccgtccccagtgctggaagagagagacagccgaaggaagaaggacagaagtcctccttctccttctccagtggcatcgaccagtcacctggaatgtcgccagtacccctcagagagccaatgaaggcaccgctgtgtggagagggggaccagcctggtggttttgagtcccaagagaaagaggctgcaggtggctttccccctgcagagtccaggcagggggtggcttctgtgcaagtgacccctgaggcccctgctgcagcccagcagggcacagaaagctcagcggtcttggagaagtcccccctaaaacccatggccccgatcccacaagatccagccccaagagcctcagacagagaaagaggccaaggggaggcgccgcctcagtatttaacagatgacttggaattcctcagggcctgccatctccctaggagcaattcaggggctgccccagaagcagaagtgaatgccgcttcccaggagagctgccagcagccagtgggagcatatctgccgcacgcagagctgccctggggcttgccaagtcctgccctggtgccagaggctgggggctctgggaaggaggctctggacaccattgatgttcagggtcacccacagacagggatgcgaggaaccaagcccaatcaagttgtctgtgtggcagcaggcggccagcccgaagggggtttgcctgtgagccctgaaccttccctgctcactccgactgaggaagcacatccagcttcaagcctcgcttcattcccagctgctcagattcctattgctgtagaagaacctggatcatcatccagggaatcagtttccaaggctgggatgccagtttctgcagatgcagccaaagaggtggtggatgcagggttggtgggactggagaggcaggtgtcagatcttggaagcaagggagagcatccagaaggggaccctggagaggttcctgccccatcaccccaggagaggggagagcacttgaacacggagcaaagccatgaggtccaaccaggagtaccaccccctcctcttcccaaggagcaaagccatgaggtccaaccaggagcaccaccccctcctcttcccaaggcaccaagtgaaagtgccagagggccaccggggccaacggatggagccaaggtccatgaagattccacaagcccagccgtggctaaagaaggaagcagatcacctggtgacagccctggaggaaaggaggaagccccagagccacctgatggtggagacccagggaacctgcaaggagaggactctcaggctttcagcagcaagcgtgatccagaagtaggcaaagatgagctttcaaagccaagcagtgatgcagagagcagagaccatcccagctcacactcagcacagccacccagaaaggggggtgctgggcacacggacgggccccactctcagacagcagaggctgatgcatctggcctaccacacaagctgggtgaggaggaccccgtcctgccccctgtgccagatggagctggtgagcccactgttcccgaaggagccatctgggaggggtcaggattgcagcccaaatgtcctgacacccttcagagcagggaaggattgggaagaatggagtctttcctgactttagaatcagagaaatcagattttccaccaactcctgttgcagaggttgcacccaaagcccaggaaggtgagagcacattggaaataaggaagatgggcagctgtgatggggagggcttgctgacgtccccagatcaaccccgcgggccggcgtgtgatgcgtcgagacaggaatttcatgctggggtgccacatcccccccagggggagaacttggcagcagacctggggctcacggcactcatcctggaccaagatcagcagggaatcccatcctgcccaggggaaggctggataagaggagctgcatccgagtggcccctactatcttctgagaagcatctccagccatcccaggcacaaccagagacatccatctttgacgtgctcaaggagcaggcccagccacctgaaaatgggaaagagacttctccaagccatccaggttttaaggaccagggagcagattcttcccaaatccatgtacctgtggaacctcaggaagataacaacttgcccactcatggaggacaggagcaggctttgggatcagaacttcaaagtcagctccccaaaggcaccctgtctgatactccaacttcatctcccactgacatggtttgggagagttctctgacagaagagtcagaattgtcagcaccaacgagacagaagttgcctgcactaggggagaagcggccagagggagcatgcggtgatggtcagtcctcgagggtctcgcctccagcagcagatgtcttaaaagacttttctcttgcagggaacttcagcagaaaggaaacttgctgcactgggcaggggccaaacaagtctcaacaggcattggctgatgccttggaagaaggcagccagcatgaagaagcatgtcaaaggcatccaggagcttctgaagcagctgatggttgttccccactctggggcttgagtaagagggagatggcaagtggaaacacaggggaggccccaccttgtcagcctgactcagtagctctcctggatgcagttccctgcctgccagccctggcgcccgccagccccggagtcacacccacccaggatgccccagagacagaggcatgtgatgaaacccaggaaggcaggcagcaaccagtgccggccccgcagcagaaaatggagtgctgggccacttcggatgcagagtccccaaagcttcttgcaagtttcccatcagctggggagcaaggtggtgaagccggggctgctgagactggtggcagcgctggtgcaggagacccaggaaagcagcaggctccggagaaacctggagaagctactttgagttgtggcctccttcagactgagcactgccttacctccggggaggaagcttctacctctgccctacgtgagtcctgccaagctgagcaccccatggccagctgccaggatgccttgctgccagccagagagctgggtgggattcccaggagcaccatggatttttctacacaccaggctgtcccagacccaaaggagctcctgctgtctgggccaccagaagtggctgctcctgacaccccttacctgcatgtcgacagtgctgcccagagaggagcagaagacagtggagtgaaagctgtttcctctgcagaccccagagctcctggcgaaagcccctgtcctgtaggggagcccccacttgccttggaaaatgctgcctccttgaagctgtttgctggctccctcgcccccctgttgcaaccaggagctgcaggtggggaaatccctgcagtgcaagccagcagtggtagtcccaaagccagaaccactgagggaccagtggactccatgccatgcctggaccggatgccacttctggccaagggcaagcaggcaacaggggaagagaaagcagcaacagctccaggtgcaggtgccaaggccagtggggagggcatggcaggtgatgcagcaggagagacagagggcagcatggagaggatgggagagccttcccaggacccaaagcagggcacatcaggtggtgtggacacaagctctgagcaaatcgccaccctcactggcttcccagacttcagggagcacatcgccaagatcttcgagaagcctgtgctcggagccctggccacacctggagaaaaggcaggagctgggaggagtgcagtgggtaaagacctcaccaggccattgggcccagagaagcttctagatgggcctccaggagtggatgtcacccttctccctgcacctcctgctcgactccaggtggagaagaagcaacagttggctggagaggctgagatttcccatctggctctgcaagatccagcttcagacaagcttctgggtccagcagggctgacctgggagcggaacttgccaggtgccggtgtggggaaggagatggcaggtgtcccacccacactgagggaagacgagaggccagaggggcctggggcagcctggccaggcctggaaggccaggcttactcacagctggagaggagcaggcaggaattagcttcaggtcttccttcaccagcagctactcaggagctccctgtggagagagctgctgccttccaggtggctccccatagccatggagaagaggccgtggcccaagacagaattccttctggaaagcagcaccaggaaacatctgcctgcgacagtccacatggagaagatggtcccggggactttgctcacacaggggttccaggacatgtgccaaggtccacgtgtgccccttctcctcagagggaggttttgactgtgcctgaggccaacagtgagccctggacccttgacacgcttgggggtgaaaggagacccggagtcactgctggcatcttggaaatgcgaaatgccctgggcaaccagagcacccctgcaccaccaactggagaagtggcagacactcccctggagcctggcaaggtggcaggcgctgctggggaagcagagggtgacatcaccctgagcacagctgagacacaggcatgtgcgtccggtgatctgcctgaagcaggtactacgaggacattctccgttgtggcaggtgacttggtgctgccaggaagctgtcaggacccagcctgctctgacaaggctccggggatggagggtacagctgcccttcatggggacagcccagccaggccccagcaggctaaggagcagccagggcctgagcgccccattccagctggggatgggaaggtgtgcgtctcctcacctccagagcctgacgaaactcacgacccgaagctgcaacatttggctccagaagagctccacactgacagagagagccccaggcctggcccatccatgttaccttcggttcctaagaaggatgctccaagagtcatggataaagtcacttcagatgagaccagaggtgcggaaggaacagaaagttcacctgtggcagatgatatcatccagcccgctgcccccgcagacctggaaagcccaaccttagctgcctcttcctaccacggtgatgttgttggccaggtctctacggatctgatagcccagagcatctccccagctgctgcccatgcgggtcttcctccctcggctgcagaacacatagtttcgccatctgccccagctggtgacagagtagaagcttccactccctcctgcccagatccggccaaggacctcagcaggataccctgaaccacctctgtactctgcagagtccccaccagcaagaaggccctcaccagatgctgccccttgacctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]