GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-17 00:57:09, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_016999995            4770 bp    mRNA    linear   PRI 17-AUG-2020
DEFINITION  PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type
            U (PTPRU), transcript variant X5, mRNA.
ACCESSION   XM_016999995
VERSION     XM_016999995.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000001.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200815
            Annotation Version          :: 109.20200815
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4770
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
     gene            1..4770
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /note="protein tyrosine phosphatase receptor type U;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 mRNA, 102 ESTs, 29 long SRA reads, 1
                     Protein, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 3 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:10076"
                     /db_xref="HGNC:HGNC:9683"
                     /db_xref="MIM:602454"
     variation       2
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545360469"
     variation       8
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574624129"
     variation       12
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258923911"
     variation       15
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:996241960"
     variation       15
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1262497723"
     variation       17
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574624165"
     variation       21
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357281491"
     variation       24
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564935273"
     variation       33
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887761864"
     variation       38
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005274670"
     variation       39
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175227869"
     variation       44
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12404526"
     variation       65
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183440413"
     CDS             66..3629
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /codon_start=1
                     /product="receptor-type tyrosine-protein phosphatase U
                     isoform X5"
                     /protein_id="XP_016855484.1"
                     /db_xref="GeneID:10076"
                     /db_xref="HGNC:HGNC:9683"
                     /db_xref="MIM:602454"
                     /translation="
MRSDLGVGAGFEGDGQGQEPPTPIAPPQLLRAGPTYLIIQLNTNSIIGDGPIVRKEIEYRMARGPWAEVHAVSLQTYKLWHLDPDTEYEISVLLTRPGDGGTGRPGPPLISRTKCAEPMRAPKGLAFAEIQARQLTLQWEPLGYNVTRCHTYTVSLCYHYTLGSSHNQTIRECVKTEQGVSRYTIKNLLPYRNVHVRLVLTNPEGRKEGKEVTFQTDEDVPSGIAAESLTFTPLEDMIFLKWEEPQEPNGLITQYEISYQSIESSDPAVNVPGPRRTISKLRNETYHVFSNLHPGTTYLFSVRARTGKGFGQAALTEITTNISAPSFDYADMPSPLGESENTITVLLRPAQGRGAPISVYQVIVEEERARRLRREPGGQDCFPVPLTFEAALARGLVHYFGAELAASSLPEAMPFTVGDNQTYRGFWNPPLEPRKAYLIYFQAASHLKGETRLNCIRIARKAACKESKRPLEVSQRSEEMGLILGICAGGLAVLILLLGAIIVIIRKGRDHYAYSYYPKPVNMTKATVNYRQEKTHMMSAVDRSFTDQSTLQEDERLGLSFMDTHGYSTRGDQRSGGVTEASSLLGGSPRRPCGRKGSPYHTGQLHPAVRVADLLQHINQMKTAEGYGFKQEYESFFEGWDATKKKDKVKGSRQEPMPAYDRHRVKLHPMLGDPNADYINANYIDIRINREGYHRSNHFIATQGPKPEMVYDFWRMVWQEHCSSIVMITKLVEVGRVKCSRYWPEDSDTYGDIKIMLVKTETLAEYVVRTFALERRGYSARHEVRQFHFTAWPEHGVPYHATGLLAFIRRVKASTPPDAGPIVIHCSAGTGRTGCYIVLDVMLDMAECEGVVDIYNCVKTLCSRRVNMIQTEEQYIFIHDAILEACLCGETTIPVSEFKATYKEMIRIDPQSNSSQLREEFQTLNSVTPPLDVEECSIALLPRNRDKNRSMDVLPPDRCLPFLISTDGDSNNYINAALTDSYTRSAAFIVTLHPLQSTTPDFWRLVYDYGCTSIVMLNQLNQSNSAWPCLQYWPEPGRQQYGLMEVEFMSGTADEDLVARVFRVQNISRLQEGHLLVRHFQFLRWSAYRDTPDSKKAFLHLLAEVDKWQAESGDGRTIVHCLNGGGRSGTFCACATVLEMIRCHNLVDVFFAAKTLRNYKPNMVETMDQYHFCYDVALEYLEGLESR"
     variation       66
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1002292021"
     variation       71
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1382838718"
     variation       75
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463376045"
     variation       76
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961281510"
     variation       77
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035267664"
     variation       84
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992661943"
     variation       86
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296749666"
     variation       90
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960941919"
     variation       91
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972113773"
     variation       96
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574624280"
     variation       98
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773672581"
     variation       100
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574624291"
     variation       106
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550697403"
     variation       107
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026718996"
     variation       108
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952049900"
     variation       111
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970223025"
     variation       115
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245207483"
     variation       116
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574624324"
     variation       117
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315682633"
     variation       122
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301122115"
     variation       129
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148349447"
     variation       139
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775440824"
     variation       140
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557045961"
     variation       141
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763919581"
     variation       142
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200088829"
     variation       145..148
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="caca"
                     /replace="cacaca"
                     /db_xref="dbSNP:1326826823"
     variation       147
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227555601"
     variation       149
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368989564"
     variation       156
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764943961"
     variation       157
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77846932"
     variation       159
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373682109"
     variation       160
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222720443"
     variation       164
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451060079"
     variation       167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202132621"
     variation       169
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988442037"
     variation       176
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369094441"
     variation       182
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471852569"
     variation       184
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558557865"
     variation       186
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290092044"
     variation       193
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746485300"
     variation       200..205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1553365272"
     variation       203
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364063585"
     variation       205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454991503"
     variation       209
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161050516"
     variation       210
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389411627"
     variation       213
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755590386"
     variation       217
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200535287"
     variation       218
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775160621"
     variation       219
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769995940"
     variation       220
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409040942"
     variation       221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773507256"
     variation       223
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318464490"
     variation       226
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241477456"
     variation       228
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1263845459"
     variation       230
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355735436"
     variation       232
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223313718"
     variation       234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749473209"
     variation       237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760439143"
     variation       239
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774465671"
     variation       240
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:989135088"
     variation       241
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558558014"
     variation       242
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408787926"
     variation       243
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759602878"
     variation       244
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764162839"
     variation       246
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184974004"
     variation       247
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367530117"
     variation       249
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776361366"
     variation       251
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202200992"
     variation       252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368676485"
     variation       254
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429066456"
     variation       255
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150643953"
     variation       257
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573346927"
     variation       260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766106101"
     variation       265
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751172417"
     variation       270
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574625378"
     variation       275
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296479585"
     variation       276
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754379288"
     variation       278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279687694"
     variation       280
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781729728"
     variation       283
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545730447"
     variation       293
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756535014"
     variation       296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205098380"
     variation       298
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749634298"
     variation       299
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771203901"
     variation       304
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180471157"
     variation       307
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200476689"
     variation       308
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313581246"
     variation       309
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255107727"
     variation       311
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359275159"
     variation       317
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444836766"
     variation       322
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779106598"
     variation       323
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210809400"
     variation       326
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387808622"
     variation       330
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745948916"
     variation       333
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1171067110"
     variation       337
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356203293"
     variation       338
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464407458"
     variation       339
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771984879"
     variation       344
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405678043"
     variation       347
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201004806"
     variation       349
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233567141"
     variation       350
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373684691"
     variation       351
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363128217"
     variation       356
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769737368"
     variation       358
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773188953"
     variation       359
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762826676"
     variation       361
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766201050"
     variation       362
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115945321"
     variation       365
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445096904"
     variation       370
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759109068"
     variation       375
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262946601"
     variation       377
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909300661"
     variation       380
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574625683"
     variation       386
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574625687"
     variation       388
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462009974"
     variation       390
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205189686"
     variation       395
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766899103"
     variation       397
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574625715"
     variation       400
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464102140"
     variation       401
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231844513"
     variation       403
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752222290"
     variation       406
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72649292"
     variation       410
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1431337609"
     variation       411
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175217686"
     variation       413
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778243643"
     variation       418
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770800809"
     variation       420
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774180157"
     variation       421
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959632213"
     variation       422
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567419585"
     variation       424
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286812917"
     variation       426
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767178701"
     variation       427
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557437634"
     variation       428
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142038734"
     variation       429
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764593080"
     variation       433
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992386548"
     variation       441
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917943637"
     variation       445
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319405195"
     variation       450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278076410"
     variation       456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221081715"
     variation       457
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754281839"
     variation       458
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461837314"
     variation       460
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757637278"
     variation       462
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199598502"
     variation       463
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188935262"
     variation       466
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112655463"
     variation       470
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758595009"
     variation       474
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764152404"
     variation       478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410433594"
     variation       483
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201530682"
     variation       486
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753860935"
     variation       488
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366778445"
     variation       489
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749198271"
     variation       499
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476871993"
     variation       500
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112126003"
     variation       505
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750632643"
     variation       506
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745659997"
     variation       507
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771686501"
     variation       508
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775138343"
     variation       516
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244663161"
     variation       522
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407427961"
     variation       524
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760111768"
     variation       529
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763550469"
     variation       530
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777157836"
     variation       533
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272123342"
     variation       536
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762350700"
     variation       537
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206343055"
     variation       538
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234861418"
     variation       540
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442972080"
     variation       541
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574648166"
     variation       543
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765712745"
     variation       546
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750813678"
     variation       550
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758786587"
     variation       553
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972529303"
     variation       556
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396401370"
     variation       560
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:534838486"
     variation       561
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751746624"
     variation       565
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755139125"
     variation       568..570
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:754474692"
     variation       573
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781460636"
     variation       574
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1384371565"
     variation       576
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748214576"
     variation       577
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757320195"
     variation       582
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1339969438"
     variation       585
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778902967"
     variation       589
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949821700"
     variation       600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111456945"
     variation       601
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745651327"
     variation       605
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434690559"
     variation       609
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557784273"
     variation       610
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775032590"
     variation       615
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746629081"
     variation       618
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045863349"
     variation       620
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191094158"
     variation       624
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373055373"
     variation       637
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768269652"
     variation       638
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371453562"
     variation       639
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145823140"
     variation       640
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761301664"
     variation       642
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571821576"
     variation       643
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936964613"
     variation       644
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758999072"
     variation       645
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537215101"
     variation       646
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766726685"
     variation       650
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751838866"
     variation       651
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759884380"
     variation       655
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229548485"
     variation       656
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453745616"
     variation       666
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752889478"
     variation       667
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159666780"
     variation       668
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1387690496"
     variation       680
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756193219"
     variation       681
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054752703"
     variation       682..694
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gcaa"
                     /replace="gcaaagagggcaa"
                     /db_xref="dbSNP:780541187"
     variation       682
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35745442"
     variation       683
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406991274"
     variation       687
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758163416"
     variation       689
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779943702"
     variation       690
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285689403"
     variation       692
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746786939"
     variation       697
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768357603"
     variation       698
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780820227"
     variation       699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574648595"
     variation       708
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195964957"
     variation       710
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747663497"
     variation       712
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574283151"
     variation       713
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773615087"
     variation       718
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354103352"
     variation       719
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763555638"
     variation       725
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390604943"
     variation       726
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780836731"
     variation       728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747750799"
     variation       733
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241329233"
     variation       738
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313050728"
     variation       740
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358754416"
     variation       741
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533690295"
     variation       743
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35932909"
     variation       744
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756633219"
     variation       755
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200502248"
     variation       762
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774929231"
     variation       764
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759990211"
     variation       765
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772512200"
     variation       766
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384089441"
     variation       768
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444645432"
     variation       770
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165471806"
     variation       774
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352680476"
     variation       779
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461338949"
     variation       796
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775882102"
     variation       800
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148293511"
     variation       802
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907538668"
     variation       811
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764204163"
     variation       813
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776833843"
     variation       816
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761797398"
     variation       823
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150842094"
     variation       827
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306243879"
     variation       829
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227202193"
     variation       830
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252285913"
     variation       834
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907609500"
     variation       837
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776652943"
     variation       842
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761968272"
     variation       843
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485227658"
     variation       845
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143580709"
     variation       847
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557442149"
     variation       851
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774304347"
     variation       852
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746633101"
     variation       865
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373947377"
     variation       866
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146208154"
     variation       870
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470441876"
     variation       875
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199754745"
     variation       876
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201821547"
     variation       879
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753380680"
     variation       889
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371266065"
     variation       891
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756818305"
     variation       892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403532640"
     variation       894
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919785307"
     variation       899
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1317834071"
     variation       904
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778603022"
     variation       905
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346492375"
     variation       909
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769242189"
     variation       910
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370694990"
     variation       913
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144456016"
     variation       917
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215865672"
     variation       918
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574653734"
     variation       920
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200125249"
     variation       935
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257061844"
     variation       937
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141637360"
     variation       938
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747407994"
     variation       942
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768845768"
     variation       943
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776936599"
     variation       945
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748279144"
     variation       953
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769972938"
     variation       954
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191556392"
     variation       955
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142576020"
     variation       962
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574653792"
     variation       965
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478100294"
     variation       968
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140670427"
     variation       969
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375192977"
     variation       972
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406049775"
     variation       973
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418631649"
     variation       978
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183165721"
     variation       979
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775231191"
     variation       982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368514487"
     variation       983
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943913977"
     variation       984..985
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:989244820"
     variation       984
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040734490"
     variation       986
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:117122029"
     variation       991
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574653890"
     variation       995
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187052302"
     variation       996
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277468526"
     variation       1001
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372130058"
     variation       1002
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557442517"
     variation       1003
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150267021"
     variation       1004
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750023335"
     variation       1007
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757917846"
     variation       1008
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350317572"
     variation       1010
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780625689"
     variation       1013
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292407071"
     variation       1017
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751964101"
     variation       1024
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202158845"
     variation       1028
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200865092"
     variation       1029
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376299815"
     variation       1040
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753064744"
     variation       1043
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756411267"
     variation       1044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367633133"
     variation       1046
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574654553"
     variation       1054
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764564395"
     variation       1055
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371739078"
     variation       1056
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771105941"
     variation       1058
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:960537450"
     variation       1063
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754296328"
     variation       1064
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745951491"
     variation       1067
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574654619"
     variation       1068
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341692539"
     variation       1076
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428571913"
     variation       1080
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269460155"
     variation       1085
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003151860"
     variation       1087
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314818938"
     variation       1088
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768547107"
     variation       1097
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148921515"
     variation       1098
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747973212"
     variation       1100
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769664316"
     variation       1103
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897198194"
     variation       1111
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202066264"
     variation       1112
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201241001"
     variation       1113
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217243583"
     variation       1120
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444144728"
     variation       1122
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369488427"
     variation       1123
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766033489"
     variation       1124
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773799165"
     variation       1125
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283282681"
     variation       1129
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138353108"
     variation       1130
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767921472"
     variation       1134
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753152609"
     variation       1142
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333021035"
     variation       1148
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761217742"
     variation       1154
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764568294"
     variation       1157
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147204318"
     variation       1167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757579431"
     variation       1168
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141378439"
     variation       1171
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758440077"
     variation       1172
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780322316"
     variation       1173
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373382555"
     variation       1174
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756178981"
     variation       1182
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429802390"
     variation       1183
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139042764"
     variation       1185
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380386412"
     variation       1186
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440930100"
     variation       1187
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201851473"
     variation       1188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384517700"
     variation       1192
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045451"
     variation       1195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341395655"
     variation       1199
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376493752"
     variation       1202
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458259120"
     variation       1204
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1268603319"
     variation       1205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552985364"
     variation       1211
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574658455"
     variation       1212
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394004581"
     variation       1214
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778460941"
     variation       1218
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557445996"
     variation       1220
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80072461"
     variation       1221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368857411"
     variation       1223
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042591455"
     variation       1225
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313619915"
     variation       1226
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775035994"
     variation       1229
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760171185"
     variation       1230
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769159207"
     variation       1234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762111865"
     variation       1235
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765600568"
     variation       1237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238402323"
     variation       1239
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143248099"
     variation       1245
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763284942"
     variation       1246
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241945183"
     variation       1249..1257
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gc"
                     /replace="gcctggtgc"
                     /db_xref="dbSNP:1424353093"
     variation       1249
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449618455"
     variation       1254
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372566755"
     variation       1256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447456728"
     variation       1258
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371134020"
     variation       1259
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461294257"
     variation       1261
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170313181"
     variation       1263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751757583"
     variation       1265
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148761398"
     variation       1266
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334824831"
     variation       1268..1279
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ggccgaactggc"
                     /replace="ggccgaactggccgaactggc"
                     /db_xref="dbSNP:1378462162"
     variation       1268
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777872587"
     variation       1271
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535081694"
     variation       1272
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325119356"
     variation       1277..1278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1173860235"
     variation       1278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151313946"
     variation       1279
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147046605"
     variation       1280
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142462225"
     variation       1281
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201336587"
     variation       1285
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779619206"
     variation       1287
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746539126"
     variation       1289
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318851717"
     variation       1294
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386342627"
     variation       1296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768110231"
     variation       1301
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364723313"
     variation       1307
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436019907"
     variation       1311
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752265933"
     variation       1313
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762423778"
     variation       1321
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574658774"
     variation       1329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770180060"
     variation       1331
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425451005"
     variation       1336
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467399917"
     variation       1343
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310482041"
     variation       1348
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574658814"
     variation       1349
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370713276"
     variation       1353
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441993616"
     variation       1354
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174468524"
     variation       1356
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773685454"
     variation       1357
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937518889"
     variation       1359..1368
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="gagcctagga"
                     /db_xref="dbSNP:1466612901"
     variation       1360
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305171137"
     variation       1361
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346931110"
     variation       1371
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763224105"
     variation       1373
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1004912917"
     variation       1382
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766721153"
     variation       1388
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751780427"
     variation       1391
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199827632"
     variation       1395
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221308050"
     variation       1403
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560820818"
     variation       1408
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300162481"
     variation       1409
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312328083"
     variation       1410
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767744520"
     variation       1412
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258935881"
     variation       1418
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423180895"
     variation       1420
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780706633"
     variation       1426
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747699412"
     variation       1431
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755529253"
     variation       1432
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370746849"
     variation       1434
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749851774"
     variation       1437
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446862039"
     variation       1444
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771540763"
     variation       1445
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894210397"
     variation       1457
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371492891"
     variation       1466
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384295445"
     variation       1468
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557448747"
     variation       1469
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759261859"
     variation       1470
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767213601"
     variation       1471
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752250395"
     variation       1473
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763820625"
     variation       1477
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1256447461"
     variation       1479
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454232372"
     variation       1480
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320192334"
     variation       1484
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343481840"
     variation       1487
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190089304"
     variation       1489
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753385501"
     variation       1493
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757903277"
     variation       1495
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770336069"
     variation       1496
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779491423"
     variation       1503
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746246072"
     variation       1506
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474004669"
     variation       1508
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772273324"
     variation       1509
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026420879"
     variation       1527
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911884696"
     variation       1528
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753493867"
     variation       1530..1535
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:764235465"
     variation       1540
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780357940"
     variation       1546..1581
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="tcatcc"
                     /replace="tcatccttctcctgggtgccatcattgtcatcatcc"
                     /db_xref="dbSNP:1172300112"
     variation       1547
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544754887"
     variation       1550
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768904318"
     variation       1554
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1337595138"
     variation       1555
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776750652"
     variation       1556
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269986653"
     variation       1559
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041823673"
     variation       1569..1571
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="att"
                     /db_xref="dbSNP:1360798473"
     variation       1570
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1557449027"
     variation       1575
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428508088"
     variation       1576
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138841821"
     variation       1580
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770860645"
     variation       1581
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774218458"
     variation       1582
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780379580"
     variation       1587
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343028764"
     variation       1589
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333431120"
     variation       1593
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213354415"
     variation       1594
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401183959"
     variation       1595
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446283633"
     variation       1596
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488850406"
     variation       1600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772032499"
     variation       1601
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219210912"
     variation       1607
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265663818"
     variation       1615
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1450709407"
     variation       1616
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775214710"
     variation       1618
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199905412"
     variation       1622
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393655779"
     variation       1624
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311206945"
     variation       1625
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116098859"
     variation       1627
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775437270"
     variation       1631
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746799427"
     variation       1632
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768529236"
     variation       1633
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197564184"
     variation       1644
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527888616"
     variation       1645..1646
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:754075527"
     variation       1646
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761609935"
     variation       1647
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376574571"
     variation       1651
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255358253"
     variation       1655
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424220050"
     variation       1656
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305540982"
     variation       1657
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772668777"
     variation       1658
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141786387"
     variation       1660..1664
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1476973794"
     variation       1660
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170159718"
     variation       1667
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766810211"
     variation       1668
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463582375"
     variation       1674
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891552255"
     variation       1676
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188432284"
     variation       1678
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752058506"
     variation       1679
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755369010"
     variation       1680
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:928388049"
     variation       1681
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767916161"
     variation       1682
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41302038"
     variation       1683
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217637863"
     variation       1685
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777985162"
     variation       1686
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749337965"
     variation       1687
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1207375816"
     variation       1688
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757309879"
     variation       1692
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140574807"
     variation       1695
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747005244"
     variation       1702
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768694899"
     variation       1706
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776629496"
     variation       1708
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150111261"
     variation       1709
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424574176"
     variation       1714
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430417219"
     variation       1716
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362201750"
     variation       1722
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975023279"
     variation       1723
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769574394"
     variation       1724
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772864093"
     variation       1726
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534134393"
     variation       1727
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553764781"
     variation       1728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149813959"
     variation       1730
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760091774"
     variation       1731
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768006172"
     variation       1732
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377692219"
     variation       1734
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760966655"
     variation       1738
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218017975"
     variation       1746
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371247916"
     variation       1748
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757388180"
     variation       1750
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779101252"
     variation       1752
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992641599"
     variation       1754
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283786188"
     variation       1756..1760
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="cccat"
                     /db_xref="dbSNP:762188899"
     variation       1756
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755036701"
     variation       1759
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374736449"
     variation       1761
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486983260"
     variation       1765
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200968040"
     variation       1768
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312405083"
     variation       1773
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558954146"
     variation       1774
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769583142"
     variation       1775
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777323857"
     variation       1780
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776818962"
     variation       1781
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557468958"
     variation       1782
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961932649"
     variation       1785
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148597380"
     variation       1790
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771530684"
     variation       1791
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147675664"
     variation       1792
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866352816"
     variation       1797
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61729921"
     variation       1801..1802
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:750843953"
     variation       1805
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140494175"
     variation       1807
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215725115"
     variation       1811
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377277838"
     variation       1818
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762018068"
     variation       1820
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205903828"
     variation       1823
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765510662"
     variation       1826
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472040056"
     variation       1827
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181666474"
     variation       1829
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773522864"
     variation       1831
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559788899"
     variation       1832
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532193157"
     variation       1833
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751669884"
     variation       1835
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756140634"
     variation       1836
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763868325"
     variation       1837
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201570633"
     variation       1838
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447139102"
     variation       1842
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931150960"
     variation       1843
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756949812"
     variation       1847..1848
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1217465879"
     variation       1848
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149545916"
     variation       1849
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200085066"
     variation       1851
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886893455"
     variation       1854
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758023346"
     variation       1855
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213987537"
     variation       1862
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779595048"
     variation       1863
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746498953"
     variation       1865
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2295061"
     variation       1870
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146215972"
     variation       1871
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748568462"
     variation       1873
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770246947"
     variation       1874
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141680370"
     variation       1876
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763319341"
     variation       1877
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766702671"
     variation       1881
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475479461"
     variation       1885
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867877309"
     variation       1886
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200605710"
     variation       1888
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139349633"
     variation       1889
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764110764"
     variation       1893
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144662614"
     variation       1894
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757186665"
     variation       1896
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765064227"
     variation       1898
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199628688"
     variation       1899
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145708690"
     variation       1901
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015163733"
     variation       1904
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150988287"
     variation       1907
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754397567"
     variation       1910
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369052583"
     variation       1917
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219231376"
     variation       1921
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748647049"
     variation       1922
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770406013"
     variation       1926
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778343280"
     variation       1933
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140979819"
     variation       1934
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771289142"
     variation       1937
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138733986"
     variation       1938
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775082864"
     variation       1940
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974675542"
     variation       1942
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538867374"
     variation       1946
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137880682"
     variation       1947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765153873"
     variation       1948
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259656755"
     variation       1952
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417738957"
     variation       1954
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157846379"
     variation       1955
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162830128"
     variation       1957
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372659114"
     variation       1958
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143923802"
     variation       1959
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983956280"
     variation       1961
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750225213"
     variation       1962
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574698224"
     variation       1964
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61733825"
     variation       1981
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746238347"
     variation       1987
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186476406"
     variation       1988
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147297333"
     variation       1989
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747115361"
     variation       1997
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768683126"
     variation       2009
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910621599"
     variation       2010
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371079414"
     variation       2012
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943227611"
     variation       2013
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776661016"
     variation       2014
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749275440"
     variation       2022
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150833997"
     variation       2023
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774083255"
     variation       2024
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139236311"
     variation       2026
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393594057"
     variation       2031
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424485822"
     variation       2033
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767095595"
     variation       2034
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438142081"
     variation       2037
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004920455"
     variation       2042
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372729717"
     variation       2043
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384466759"
     variation       2049
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761326912"
     variation       2050
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140091385"
     variation       2055
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750903519"
     variation       2056
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758801155"
     variation       2058
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766779244"
     variation       2067
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751911543"
     variation       2069
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755264582"
     variation       2070
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200655838"
     variation       2071
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1384533750"
     variation       2072
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781326938"
     variation       2075
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557471353"
     variation       2078
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141019104"
     variation       2084..2087
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1236327092"
     variation       2084
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257684797"
     variation       2085
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283621509"
     variation       2086
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370440569"
     variation       2088
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771478825"
     variation       2089
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2235937"
     variation       2090
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771889225"
     variation       2091
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266062665"
     variation       2093
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374111722"
     variation       2094
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143594487"
     variation       2101
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768435626"
     variation       2106
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776375990"
     variation       2108
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761261976"
     variation       2110
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769386710"
     variation       2115
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772574986"
     variation       2116
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763576226"
     variation       2118
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200069574"
     variation       2121
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772559981"
     variation       2124
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564512646"
     variation       2126
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760891085"
     variation       2131
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764397731"
     variation       2133
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866099875"
     variation       2134
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776675710"
     variation       2135
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762098092"
     variation       2140
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776458421"
     variation       2144..2145
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1373092912"
     variation       2144
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775811963"
     variation       2149
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532350399"
     variation       2150
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470817827"
     variation       2158
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322664537"
     variation       2166
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392298851"
     variation       2167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768943590"
     variation       2168..2173
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cactca"
                     /replace="cactcactca"
                     /db_xref="dbSNP:1557477459"
     variation       2173
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777032680"
     variation       2176
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429105024"
     variation       2179
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779614135"
     variation       2180
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979844649"
     variation       2191
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542124199"
     variation       2192
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760591977"
     variation       2193
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201669618"
     variation       2196
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439328311"
     variation       2197
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374287280"
     variation       2199
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375440765"
     variation       2200
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005837484"
     variation       2208
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761545000"
     variation       2209
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746543812"
     variation       2210
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750114977"
     variation       2211
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1167829205"
     variation       2216
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758047679"
     variation       2220
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918059398"
     variation       2223
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412025858"
     variation       2224
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201177009"
     variation       2226
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751077674"
     variation       2227
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414960537"
     variation       2228
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015417936"
     variation       2233
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773694835"
     variation       2234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770246925"
     variation       2235
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349481834"
     variation       2236
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226679567"
     variation       2238
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251795647"
     variation       2240
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140673849"
     variation       2241
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138769148"
     variation       2242
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310201143"
     variation       2244
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199881617"
     variation       2245
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200884886"
     variation       2246
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188918106"
     variation       2252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258424459"
     variation       2255
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942000483"
     variation       2256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745899276"
     variation       2261
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768601463"
     variation       2262
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761708200"
     variation       2264
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423397329"
     variation       2276
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395868747"
     variation       2277
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759237592"
     variation       2280
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767188478"
     variation       2284
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322336610"
     variation       2286
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040440432"
     variation       2287
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752247574"
     variation       2296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315362007"
     variation       2297
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372277693"
     variation       2298
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764636241"
     variation       2299
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466300449"
     variation       2303
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212427445"
     variation       2309
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754172833"
     variation       2315
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142752020"
     variation       2316
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374948381"
     variation       2317
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557478916"
     variation       2320
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959790909"
     variation       2324
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746150522"
     variation       2326
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992563202"
     variation       2328
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1418213094"
     variation       2333..2343
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="gctggtgaaga"
                     /db_xref="dbSNP:1366372503"
     variation       2334
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159361871"
     variation       2337
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:918097528"
     variation       2338
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568617355"
     variation       2339
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287784590"
     variation       2345
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459385429"
     variation       2346
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780175447"
     variation       2350
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2235940"
     variation       2354
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574713089"
     variation       2360
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769738173"
     variation       2361
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216766922"
     variation       2363
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533783853"
     variation       2366
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749070547"
     variation       2367
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770802288"
     variation       2370
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773999258"
     variation       2371
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759323710"
     variation       2372
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574713181"
     variation       2374
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1190514546"
     variation       2381
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369911349"
     variation       2384
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760211050"
     variation       2388
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764537371"
     variation       2389
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754407171"
     variation       2391
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:778540811"
     variation       2392
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760370694"
     variation       2398
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1415337608"
     variation       2399
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768260484"
     variation       2400
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775989929"
     variation       2401
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357886422"
     variation       2404
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762448533"
     variation       2405
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361885848"
     variation       2406
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765597007"
     variation       2407
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547406320"
     variation       2408
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766621505"
     variation       2411
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139230218"
     variation       2412
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375188981"
     variation       2414
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443748501"
     variation       2416
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574714963"
     variation       2417
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213067349"
     variation       2418
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781393850"
     variation       2419
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905716408"
     variation       2423
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752718591"
     variation       2429
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144825402"
     variation       2430
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310256792"
     variation       2435
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1206527365"
     variation       2437
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778663291"
     variation       2438
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745686767"
     variation       2445
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892881427"
     variation       2450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478494323"
     variation       2453
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758306092"
     variation       2454
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201471973"
     variation       2456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019890558"
     variation       2464
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316316599"
     variation       2465
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238331616"
     variation       2470
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768189373"
     variation       2471
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776210002"
     variation       2474
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323115388"
     variation       2475
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747555540"
     variation       2477
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112586980"
     variation       2480
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978793043"
     variation       2487
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303045605"
     variation       2489
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773671335"
     variation       2490
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774239929"
     variation       2491
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763421785"
     variation       2492
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370363773"
     variation       2493
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143670953"
     variation       2494
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774688307"
     variation       2495
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759873400"
     variation       2496
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374116935"
     variation       2501
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767573565"
     variation       2502
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216826559"
     variation       2503
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368690546"
     variation       2506
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199318170"
     variation       2510
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756104223"
     variation       2511
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1479166204"
     variation       2512
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569729029"
     variation       2513
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750432345"
     variation       2514
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540458029"
     variation       2515
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574715429"
     variation       2516
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487021838"
     variation       2522
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780060079"
     variation       2523
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372756354"
     variation       2526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423472376"
     variation       2527
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746715574"
     variation       2529
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386652116"
     variation       2531
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:535649188"
     variation       2537
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477115276"
     variation       2538
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780660085"
     variation       2540
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747726088"
     variation       2546
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771446818"
     variation       2547
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753454967"
     variation       2548
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528489064"
     variation       2549
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195031795"
     variation       2552
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275011735"
     variation       2555
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772369273"
     variation       2556
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775907774"
     variation       2559
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760871118"
     variation       2560
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939145772"
     variation       2572
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776864464"
     variation       2576
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139267044"
     variation       2577
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376717923"
     variation       2585
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756829532"
     variation       2586
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192670605"
     variation       2590
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544809605"
     variation       2593
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431312547"
     variation       2597
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767226393"
     variation       2598
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752467292"
     variation       2600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755828193"
     variation       2602
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777386902"
     variation       2606
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371301025"
     variation       2607
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227491033"
     variation       2615
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34589663"
     variation       2616
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778440993"
     variation       2618
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207625053"
     variation       2619
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746376571"
     variation       2622
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772565654"
     variation       2625
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780351139"
     variation       2626
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747366018"
     variation       2630
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553128890"
     variation       2631..2632
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:745723144"
     variation       2632
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769048566"
     variation       2637
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776960939"
     variation       2644..2649
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:771889038"
     variation       2647
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451683171"
     variation       2648
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172122023"
     variation       2652
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1376740569"
     variation       2655
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867290552"
     variation       2656
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537523993"
     variation       2658
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780002847"
     variation       2659
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773283021"
     variation       2667
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1317151993"
     variation       2671
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362544310"
     variation       2672
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759393992"
     variation       2675
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767481420"
     variation       2677
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752489258"
     variation       2684
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331845805"
     variation       2685
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557484030"
     variation       2691
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187844671"
     variation       2700
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419812416"
     variation       2702
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757894378"
     variation       2703
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765767078"
     variation       2704
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752133289"
     variation       2706
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916420886"
     variation       2709
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192610792"
     variation       2712
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166466464"
     variation       2713
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749544640"
     variation       2714
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386926760"
     variation       2722
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374856481"
     variation       2723
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781691616"
     variation       2726
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484354323"
     variation       2729
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182271624"
     variation       2733
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413521106"
     variation       2738
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748515121"
     variation       2739
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965441644"
     variation       2740
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998591082"
     variation       2744
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163959996"
     variation       2748
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350293728"
     variation       2750
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756345416"
     variation       2755
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296187624"
     variation       2756
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1348143409"
     variation       2763
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348880020"
     variation       2772
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778030176"
     variation       2773
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143053196"
     variation       2775
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289140712"
     variation       2782
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141267043"
     variation       2784
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774359775"
     variation       2785
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312599704"
     variation       2787
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746955755"
     variation       2789
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754412601"
     variation       2798
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141497494"
     variation       2807
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272846171"
     variation       2814
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776469162"
     variation       2817
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761647543"
     variation       2818
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253404596"
     variation       2822
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150485708"
     variation       2833
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770700422"
     variation       2834
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146068581"
     variation       2842
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759091467"
     variation       2843
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2235941"
     variation       2846
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278786672"
     variation       2847
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761032911"
     variation       2851
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201987768"
     variation       2852
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754152010"
     variation       2854
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757559165"
     variation       2855
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369271634"
     variation       2858
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244757253"
     variation       2859
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477193621"
     variation       2861
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780059343"
     variation       2862
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748129270"
     variation       2865
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471014720"
     variation       2866
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769549273"
     variation       2868
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388565873"
     variation       2871
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574725058"
     variation       2873
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997812260"
     variation       2875
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323050349"
     variation       2876
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457498531"
     variation       2879
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777689742"
     variation       2882
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435375551"
     variation       2883
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749019468"
     variation       2885
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770753692"
     variation       2887
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774112678"
     variation       2892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112916671"
     variation       2893
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771724615"
     variation       2894
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1330066293"
     variation       2896
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774799825"
     variation       2897
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287521720"
     variation       2898
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569346985"
     variation       2899
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764498452"
     variation       2900
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045453"
     variation       2903
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762136052"
     variation       2905
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765546818"
     variation       2910
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372814690"
     variation       2911
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374166275"
     variation       2912
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484999693"
     variation       2915
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766483890"
     variation       2916
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751585348"
     variation       2921
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756132230"
     variation       2922
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142593689"
     variation       2925
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367070293"
     variation       2929
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472676297"
     variation       2930
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377688027"
     variation       2933
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778797101"
     variation       2934
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745525300"
     variation       2936
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149742017"
     variation       2937
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775126388"
     variation       2939..2947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ctgcc"
                     /replace="ctgcctgcc"
                     /db_xref="dbSNP:755633779"
     variation       2943
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467423160"
     variation       2945
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371240081"
     variation       2947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769247849"
     variation       2948
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375648175"
     variation       2951
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574725437"
     variation       2955
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490921022"
     variation       2957
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1033158609"
     variation       2960
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777035926"
     variation       2962
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762260649"
     variation       2964
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147548296"
     variation       2965
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773499522"
     variation       2967
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:80083765"
     variation       2969
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763226511"
     variation       2970
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766495555"
     variation       2976
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351184278"
     variation       2982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751705783"
     variation       2984
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390977360"
     variation       2990
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427473381"
     variation       2991
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306986236"
     variation       2994
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141094521"
     variation       3005
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367662634"
     variation       3011
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951023136"
     variation       3013
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452775170"
     variation       3016
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528853967"
     variation       3017
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771222978"
     variation       3018
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199673601"
     variation       3019
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146958148"
     variation       3021
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767502282"
     variation       3022
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752824188"
     variation       3023
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368448658"
     variation       3024
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750284972"
     variation       3030
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149056994"
     variation       3032
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79013663"
     variation       3033
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751186186"
     variation       3036
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574731359"
     variation       3038
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456525980"
     variation       3039
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429991369"
     variation       3042
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196278445"
     variation       3043
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376615096"
     variation       3044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372182010"
     variation       3045
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cacgcccgacttctggc"
                     /db_xref="dbSNP:1553129982"
     variation       3046
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376805421"
     variation       3047
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770333090"
     variation       3048
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551155934"
     variation       3050
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11556358"
     variation       3051
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749753031"
     variation       3054
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957664758"
     variation       3061
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368921599"
     variation       3062
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138823810"
     variation       3065
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761368413"
     variation       3066
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772329115"
     variation       3072
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265010777"
     variation       3075
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775763634"
     variation       3076
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760809964"
     variation       3079
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433842917"
     variation       3082
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269215290"
     variation       3085
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764231520"
     variation       3086
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373120664"
     variation       3087
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762890533"
     variation       3091
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433354261"
     variation       3092
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116659236"
     variation       3093
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754644904"
     variation       3096
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574731654"
     variation       3100
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780799624"
     variation       3105
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574731658"
     variation       3107
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375146224"
     variation       3108
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200774122"
     variation       3110
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777211267"
     variation       3128
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1292669844"
     variation       3129
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749768504"
     variation       3130
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771468469"
     variation       3132
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779207570"
     variation       3136
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746224045"
     variation       3140
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772465677"
     variation       3141
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202051512"
     variation       3142
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549938102"
     variation       3147
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302750834"
     variation       3149
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384138843"
     variation       3150
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490905370"
     variation       3152
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377637892"
     variation       3153
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1295789247"
     variation       3157
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756826432"
     variation       3161
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214795071"
     variation       3165
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274553514"
     variation       3171
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309912546"
     variation       3174
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764604605"
     variation       3175
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263712549"
     variation       3176
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566780533"
     variation       3177
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758911048"
     variation       3178
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373365649"
     variation       3179
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747364020"
     variation       3185
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187296625"
     variation       3186
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755298442"
     variation       3192
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781444810"
     variation       3195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748277430"
     variation       3210
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769935693"
     variation       3214
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777652634"
     variation       3215
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1319044877"
     variation       3219
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1574737046"
     variation       3221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:756835489"
     variation       3225
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745808043"
     variation       3235
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771988932"
     variation       3237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775316245"
     variation       3243
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218134256"
     variation       3244
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760433196"
     variation       3245
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768299819"
     variation       3248
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776371235"
     variation       3252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267302438"
     variation       3253
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447339415"
     variation       3255
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761314990"
     variation       3256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006876178"
     variation       3257
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326955726"
     variation       3260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948723147"
     variation       3262
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764809017"
     variation       3263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200174460"
     variation       3265..3270
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="tctc"
                     /replace="tctctc"
                     /db_xref="dbSNP:778684439"
     variation       3266
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766969618"
     variation       3270
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752010143"
     variation       3271
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755425089"
     variation       3272
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157561571"
     variation       3276
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376456276"
     variation       3284
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760058090"
     variation       3285
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371005244"
     variation       3286
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574737653"
     variation       3288
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:554386706"
     variation       3292
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752996515"
     variation       3294
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756414232"
     variation       3295
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574737684"
     variation       3296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764194126"
     variation       3297
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996914255"
     variation       3298
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445914795"
     variation       3302
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249892765"
     variation       3310
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754022401"
     variation       3311
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184560323"
     variation       3315
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757354588"
     variation       3316
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778910187"
     variation       3317
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113481027"
     variation       3319
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76884346"
     variation       3320
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164560327"
     variation       3324
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746953833"
     variation       3329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754867638"
     variation       3330
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166884290"
     variation       3331
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781101694"
     variation       3332
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393118851"
     variation       3335
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747874338"
     variation       3349
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769525596"
     variation       3353
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993800669"
     variation       3357
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772809991"
     variation       3358
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760382382"
     variation       3360
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345534082"
     variation       3363
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773027767"
     variation       3364
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574737935"
     variation       3375
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182821450"
     variation       3381
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316823043"
     variation       3384
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748901025"
     variation       3386
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226453964"
     variation       3389
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026005333"
     variation       3393
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253813299"
     variation       3394..3399
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="ccgaga"
                     /db_xref="dbSNP:1574737998"
     variation       3395
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144077160"
     variation       3396
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340126934"
     variation       3398
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408295946"
     variation       3400
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200264736"
     variation       3401
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574738055"
     variation       3405
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574738067"
     variation       3406
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574738072"
     variation       3411
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760151569"
     variation       3412
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374427295"
     variation       3414
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574738104"
     variation       3415
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557493387"
     variation       3416
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184603583"
     variation       3417
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775969085"
     variation       3419
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201795899"
     variation       3422
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:758227404"
     variation       3427
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414122586"
     variation       3428
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754077567"
     variation       3429
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463100080"
     variation       3430
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170225677"
     variation       3433
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771572984"
     variation       3434
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144540053"
     variation       3436
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761189855"
     variation       3438
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557495010"
     variation       3439
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414804617"
     variation       3445
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764451710"
     variation       3449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776976048"
     variation       3450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159108440"
     variation       3452
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226458121"
     variation       3453
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574741088"
     variation       3455
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765424070"
     variation       3456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574741102"
     variation       3461
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750558328"
     variation       3462
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207667534"
     variation       3467
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139467328"
     variation       3468
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142593881"
     variation       3469
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374095972"
     variation       3470
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282256829"
     variation       3471
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574741174"
     variation       3473
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409664993"
     variation       3477
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756048969"
     variation       3478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159633959"
     variation       3483
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540351799"
     variation       3485
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867854392"
     variation       3488
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753668885"
     variation       3490
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757016780"
     variation       3491
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937555778"
     variation       3492
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778674703"
     variation       3499
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772282497"
     variation       3500
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1304974032"
     variation       3510
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771500483"
     variation       3522
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779554853"
     variation       3530
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747537252"
     variation       3538
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319082969"
     variation       3539
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244174340"
     variation       3544
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327084796"
     variation       3546
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202317107"
     variation       3551
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769139036"
     variation       3558
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359624079"
     variation       3560
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224084303"
     variation       3563
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777031172"
     variation       3565
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762136160"
     variation       3574
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75418232"
     variation       3579
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770155445"
     variation       3587
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557495743"
     variation       3588
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773558468"
     variation       3590
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371250281"
     variation       3593
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774340661"
     variation       3600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1028761673"
     variation       3602
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762342695"
     variation       3610
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199511118"
     variation       3611..3614
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1574742231"
     variation       3612
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539301719"
     variation       3614
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297081817"
     variation       3615
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321414984"
     variation       3616
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574742272"
     variation       3618
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202925672"
     variation       3620
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954811404"
     variation       3621
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767662583"
     variation       3625
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462502244"
     variation       3630
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776725310"
     variation       3633
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761779302"
     variation       3635
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485630463"
     variation       3638
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765013340"
     variation       3641..3642
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:773491131"
     variation       3642
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479763844"
     variation       3643
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366153716"
     variation       3644..3647
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="gggg"
                     /db_xref="dbSNP:763165419"
     variation       3644
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987392907"
     variation       3646
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750219967"
     variation       3647
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574742382"
     variation       3653
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259235320"
     variation       3656
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425328387"
     variation       3658
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758036769"
     variation       3661
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766025298"
     variation       3663
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754504692"
     variation       3665
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431008363"
     variation       3671
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290160409"
     variation       3673
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780621948"
     variation       3675
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459776659"
     variation       3676
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748657115"
     variation       3677
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283883161"
     variation       3678
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325513421"
     variation       3680
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756639334"
     variation       3687
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967069984"
     variation       3691
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978386792"
     variation       3699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898374958"
     variation       3700
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372732208"
     variation       3705
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461313864"
     variation       3707
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765826238"
     variation       3719
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11556356"
     variation       3720
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312511413"
     variation       3722
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937049224"
     variation       3725
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025397574"
     variation       3727
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055323176"
     variation       3728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916739192"
     variation       3738
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269332074"
     variation       3750
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329155385"
     variation       3751
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1258565450"
     variation       3754
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429777952"
     variation       3757
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574742619"
     variation       3768
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377546463"
     variation       3771
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574742629"
     variation       3776
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549940917"
     variation       3781
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574742652"
     variation       3783
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:68078224"
     variation       3786
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201648724"
     variation       3793
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886651105"
     variation       3799
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178374999"
     variation       3800
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412704253"
     variation       3809
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:958601598"
     variation       3814
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157076880"
     variation       3815
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199996539"
     variation       3816
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914822604"
     variation       3818
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574742726"
     variation       3821
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574742731"
     variation       3822
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469281549"
     variation       3846
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12061168"
     variation       3848
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946229414"
     variation       3852
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412069843"
     variation       3853
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289518712"
     variation       3859
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350475818"
     variation       3863
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037638340"
     variation       3867
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304185298"
     variation       3880
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923392702"
     variation       3889
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363910809"
     variation       3891
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:899275247"
     variation       3892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294890420"
     variation       3898
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:996198929"
     variation       3903
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:889148032"
     variation       3909
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028812489"
     variation       3916
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942024986"
     variation       3932
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767040661"
     variation       3933
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427292678"
     variation       3940
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433852919"
     variation       3943
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954562458"
     variation       3944
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038285708"
     variation       3946
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752326956"
     variation       3949
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994005618"
     variation       3950
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370370277"
     variation       3956
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025451310"
     variation       3965
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020204448"
     variation       3968
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967667904"
     variation       3970
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295817845"
     variation       3979
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907000620"
     variation       3981
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557496373"
     variation       3985
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369013567"
     variation       3986
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219377070"
     variation       3995
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978440778"
     variation       4007
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034494169"
     variation       4025
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486450545"
     variation       4044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:925589263"
     variation       4046
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481691635"
     variation       4050
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958435690"
     variation       4052
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011238157"
     variation       4053
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021263816"
     variation       4064
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248384451"
     variation       4072
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488845861"
     variation       4073
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967623961"
     variation       4074
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977643084"
     variation       4080
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:958470597"
     variation       4103
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476674243"
     variation       4106
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169492704"
     variation       4113
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201120198"
     variation       4114
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1429485122"
     variation       4116
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868475728"
     variation       4122
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190714523"
     variation       4131
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1062921"
     variation       4140
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986273342"
     variation       4140
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gg"
                     /replace="t"
                     /db_xref="dbSNP:370023317"
     variation       4141
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796112441"
     variation       4152
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167523719"
     variation       4159
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351037930"
     variation       4168
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1346921273"
     variation       4171
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574499069"
     variation       4172
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454231472"
     variation       4175
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324683057"
     variation       4181
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:910619512"
     variation       4183
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046965207"
     variation       4185
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368191092"
     variation       4188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770651109"
     variation       4191..4198
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cctcc"
                     /replace="cctcctcc"
                     /db_xref="dbSNP:1297892966"
     variation       4195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777426960"
     variation       4197
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142215987"
     variation       4198
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291919864"
     variation       4205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322306595"
     variation       4207
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406783095"
     variation       4217
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271298790"
     variation       4225
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757017207"
     variation       4226
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778928121"
     variation       4231
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41266215"
     variation       4232
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241813143"
     variation       4234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474626127"
     variation       4236
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184015646"
     variation       4237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919235925"
     variation       4241
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461344941"
     variation       4247
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1163426261"
     variation       4249
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929907121"
     variation       4251..4282
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gcttccctga"
                     /replace="gcttccctgatatgtgctctgagcttccctga"
                     /db_xref="dbSNP:1458360594"
     variation       4256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899159258"
     variation       4262
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1046951042"
     variation       4263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576915288"
     variation       4271
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428358289"
     variation       4276
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050532814"
     variation       4281
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:890498243"
     variation       4283
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232544771"
     variation       4292
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008742365"
     variation       4301
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020509916"
     variation       4307
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903123408"
     variation       4309
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209504642"
     variation       4310
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055581451"
     variation       4311
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283805334"
     variation       4312
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445540329"
     variation       4313
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212554361"
     variation       4315..4320
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:1223989456"
     variation       4322
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475091690"
     variation       4327
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1000098528"
     variation       4328
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772227458"
     variation       4329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473279114"
     variation       4338..4339
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1557496863"
     variation       4338
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775759549"
     variation       4348
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398551096"
     variation       4354
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335796883"
     variation       4358
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359459867"
     variation       4360
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414011001"
     variation       4363
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011289019"
     variation       4364
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75083199"
     variation       4365..4370
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:967024602"
     variation       4365
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747165315"
     variation       4366
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574743598"
     variation       4369
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1024065579"
     variation       4375
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1030999756"
     variation       4381
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574743622"
     variation       4388
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868252960"
     variation       4389
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574743633"
     variation       4398
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1158304499"
     variation       4400
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563075964"
     variation       4402
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254565209"
     variation       4447
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426655684"
     variation       4448
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1181755774"
     variation       4449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574743683"
     variation       4450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362660469"
     variation       4452
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910683742"
     variation       4456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173965464"
     variation       4457
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768987858"
     variation       4459
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403301813"
     variation       4466
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528519325"
     variation       4471
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879414076"
     variation       4472
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372216886"
     variation       4475
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776841837"
     variation       4485
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1374494364"
     variation       4490
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333982463"
     variation       4491
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554162928"
     variation       4496
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920637726"
     variation       4498
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542525016"
     variation       4503
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050825798"
     variation       4506
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890560049"
     variation       4512
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277161635"
     variation       4513
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343343738"
     variation       4515
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944766817"
     variation       4517
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1249121065"
     variation       4523
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041578924"
     variation       4526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200434802"
     variation       4527
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903010107"
     variation       4528
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000151230"
     variation       4530
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253209549"
     variation       4531
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938575881"
     variation       4534
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291847701"
     variation       4543
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391727137"
     variation       4549
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574743907"
     variation       4552
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462306317"
     variation       4553..4563
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gt"
                     /replace="gtaggaccagt"
                     /db_xref="dbSNP:1358340585"
     variation       4553
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557497191"
     variation       4554
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167254764"
     variation       4559
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218905849"
     variation       4564
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388567127"
     variation       4570
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1056035512"
     variation       4576
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553131366"
     variation       4578
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1032930542"
     variation       4579..4583
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1438914970"
     variation       4580
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300110552"
     variation       4596
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011362777"
     variation       4599
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557497281"
     variation       4606
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:562329398"
     variation       4608
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042811529"
     variation       4610
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998515601"
     variation       4619
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029964422"
     variation       4623
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273220275"
     variation       4624
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890706767"
     variation       4629
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176367915"
     variation       4632
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894360935"
     variation       4634
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770090283"
     variation       4636
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428880299"
     variation       4637
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371233220"
     variation       4640
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018203061"
     variation       4643
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963500786"
     variation       4644
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527287691"
     variation       4646
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460004837"
     variation       4650
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322793911"
     variation       4652
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527654687"
     variation       4654
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971194445"
     variation       4655
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293838060"
     variation       4660
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342663612"
     variation       4661
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973482272"
     variation       4663..4665
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1026352543"
     variation       4665
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1403872172"
     variation       4666
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172825658"
     variation       4671
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211338495"
     variation       4675
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:568275366"
     variation       4680
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441977712"
     variation       4685
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:950752352"
     variation       4686
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574744218"
     variation       4689
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015127609"
     variation       4692
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425347295"
     variation       4695
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574744236"
     variation       4696
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962183275"
     variation       4704
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982527186"
     variation       4707
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181469292"
     variation       4719
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296765675"
     variation       4735
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533033271"
     variation       4736
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146531759"
     variation       4737
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161515242"
     variation       4739
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569855586"
     variation       4742
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453268722"
     variation       4747
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287352527"
     variation       4751
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920854652"
     variation       4752
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:932209635"
     variation       4753
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312788466"
     variation       4757
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986170020"
     variation       4760
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911865637"
     variation       4768
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944841859"
ORIGIN      
cggcagggtgtcgctggggcgctatctgaagatgggcctgtggaaatggcagtggcccagccgggatgagatctgatctaggggtcggggctggcttcgagggggacggacagggtcaagagcccccaactcccatcgcgcccccacagctgctgcgtgctggccccacctacctcatcatccagctcaacaccaactccatcattggcgacgggccgatcgtgcgcaaggagattgagtaccgcatggcgcgcgggccctgggctgaggtgcacgccgtcagcctgcagacctacaagctgtggcacctcgaccccgacacagagtatgagatcagcgtgctgctcacgcgtcccggagacggcggcactggccgccctgggccacccctcatcagccgcaccaaatgcgcagagcccatgagggcccccaaaggcctggcttttgctgagatccaggcccgtcagctgaccctgcagtgggaaccactgggctacaacgtgacgcgttgccacacctatactgtgtcgctgtgctatcactacaccctgggcagcagccacaaccagaccatccgagagtgtgtgaagacagagcaaggtgtcagccgctacaccatcaagaacctgctgccctatcggaacgttcacgtgaggcttgtcctcactaaccctgaggggcgcaaagagggcaaggaggtcactttccagacggatgaggatgtgcccagtgggattgcagccgagtccctgaccttcactccactggaggacatgatcttcctcaagtgggaggagccccaggagcccaatggtctcatcacccagtatgagatcagctaccagagcatcgagtcatcagacccggcagtgaacgtgccaggcccacgacgtaccatctccaagctccgcaatgagacctaccatgtcttctccaacctgcacccaggcaccacctacctgttctccgtgcgggcccgcacaggcaaaggcttcggccaggcggcactcactgagataaccactaacatctctgctcccagctttgattatgccgacatgccgtcacccctgggcgagtctgagaacaccatcaccgtgctgctgaggccggcacagggccgcggtgcgcccatcagtgtgtaccaggtgattgtggaggaggagcgggcgcggaggctgcggcgggagccaggtggacaggactgcttcccagtgccattgaccttcgaggcggcgctggcccgaggcctggtgcactacttcggggccgaactggcggccagcagtctacctgaggccatgccctttaccgtgggtgacaaccagacctaccgaggcttctggaacccaccacttgagcctaggaaggcctatctcatctacttccaggcagcaagccacctgaagggggagacccggctgaattgcatccgcattgccaggaaagctgcctgcaaggaaagcaagcggcccctggaggtgtcccagagatcggaggagatggggcttatcctgggcatctgtgcaggggggcttgctgtcctcatccttctcctgggtgccatcattgtcatcatccgcaaagggagagaccactatgcctactcctactacccgaagccggtgaacatgaccaaggccaccgtcaactaccgccaggagaagacacacatgatgagcgccgtggaccgcagcttcacagaccagagcaccctgcaggaggacgagcggctgggcctgtccttcatggacacccatggctacagcacccggggagaccagcgcagcggtggggtcactgaggccagcagcctcctggggggctccccgaggcgtccctgtggccggaagggctccccataccacacggggcagctgcaccctgcggtgcgtgtcgcagaccttctgcagcacatcaaccagatgaagacggccgagggttacggcttcaagcaggagtatgagagcttctttgaaggctgggacgccacaaagaagaaagacaaggtcaagggcagccggcaggagccaatgcctgcctatgatcggcaccgagtgaaactgcacccgatgctgggagaccccaatgccgactacattaatgccaactacatagatattcggataaaccgagaaggttaccacaggtcaaaccacttcatagccactcaagggccgaagcctgagatggtctatgacttctggcgtatggtgtggcaggagcactgttccagcatcgtcatgatcaccaagctggtcgaggtgggcagggtgaaatgctcacggtactggccggaggactcagacacctacggggacatcaagattatgctggtgaagacagagaccctggctgagtatgtcgtgcgcacttttgccctggagcggagaggctactctgcccggcacgaggtccgccagttccacttcacagcgtggccagagcatggcgtcccctaccatgccacggggctgctggctttcatccggcgcgtgaaggcctccaccccacctgatgccgggcccattgtcatccactgcagcgcgggcaccggccgcacaggttgctatatcgtcctggatgtgatgctggacatggcagagtgtgagggcgtcgtggacatttacaactgtgtgaagactctctgctcccggcgtgtcaacatgatccagactgaggagcagtacatcttcattcatgatgcaatcctggaggcctgcctgtgtggggagaccaccatccctgtcagtgagttcaaggccacctacaaggagatgatccgcattgatcctcagagtaattcctcccagctgcgggaagagttccagacgctgaactcggtcaccccgccgctggacgtggaggagtgcagcatcgccctgttgccccggaaccgcgacaagaaccgcagcatggacgtcctgccgcccgaccgctgcctgcccttcctcatctccactgatggggactccaacaactacattaatgcagccctgactgacagctacacacggagtgcggccttcatcgtgaccctgcacccgctgcagagcaccacgcccgacttctggcggctggtctacgattacgggtgcacctccatcgtcatgctcaaccagctgaaccagtccaactccgcctggccctgcctgcagtactggccagagccaggccggcagcaatatggcctcatggaggtggagtttatgtcgggcacagctgatgaagacttagtggctcgagtcttccgggtgcagaacatctctcggttgcaggaggggcacctgctggtgcggcacttccagttcctgcgctggtctgcataccgggacacacctgactccaagaaggccttcttgcacctgctggctgaggtggacaagtggcaggccgagagtggggatgggcgcaccatcgtgcactgcctaaacgggggaggacgcagcggcaccttctgcgcctgcgccacggtcctggagatgatccgctgccacaacttggtggacgttttctttgctgccaaaaccctccggaactacaaacccaacatggtggagaccatggatcagtaccacttttgctacgatgtggccctggagtacttggaggggctggagtcaagatagcggggccctggcctggggcacccactgcacactcagggccagacccaccatcctggactggcgaggaagatcagtgcctcctgctctgcccaaacacactcccatggggcaagcactggagtggatgctgggctatcttgctcccccttccactgtgggcagggcctttcgcttgtcccatgggcgggtggtgggccaaggaggagcttagcaagtctgcagcccagccccacctccatagggtcctgcaggcctgtgctgagaggcctggtgctgcctggcagagtgacaaaggctcaggacggctggctctgggggactcaggccaagccccttggcaccatcctggcttttggcagggatgagtgaggccctgcagagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaaggtctctttaaaatggggcaggccacacccccattccgtgcctcaatttccccatctgtaaactgtagatatgactactgacctacctcgcagggggctgtggggaggcataagctgatgtttgtaaagcgctttgtaaataaacgtgctctctgaatgccaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]