GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-17 00:45:12, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_016999994            5577 bp    mRNA    linear   PRI 17-AUG-2020
DEFINITION  PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type
            U (PTPRU), transcript variant X3, mRNA.
ACCESSION   XM_016999994
VERSION     XM_016999994.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000001.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200815
            Annotation Version          :: 109.20200815
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5577
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
     gene            1..5577
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /note="protein tyrosine phosphatase receptor type U;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 mRNA, 106 ESTs, 25 long SRA reads, 1
                     Protein, and 99% coverage of the annotated genomic feature
                     by RNAseq alignments, including 2 samples with support for
                     all annotated introns"
                     /db_xref="GeneID:10076"
                     /db_xref="HGNC:HGNC:9683"
                     /db_xref="MIM:602454"
     variation       1..13
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ccgctccgctccg"
                     /replace="ccgctccgctccgctccg"
                     /db_xref="dbSNP:1415938198"
     variation       2
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486126839"
     variation       4
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1028564439"
     variation       5
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266424003"
     variation       6..7
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1334793100"
     variation       7..8
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="tccggctcgg"
                     /db_xref="dbSNP:1558537171"
     variation       7
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="gctccggctcgg"
                     /db_xref="dbSNP:1553359168"
     variation       7
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75011501"
     variation       8..30
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gctccggctcgggctccggctcg"
                     /replace="gctccggctcgggctccggctcgggctccggctcg"
                     /db_xref="dbSNP:573759885"
     variation       8
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528252386"
     variation       11
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157672242"
     variation       12
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551690133"
     variation       13..54
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ggctcgggctccgg"
                     /replace="ggctcgggctccggctcgcctcgggctgggctcgggctccgg"
                     /db_xref="dbSNP:1413074566"
     variation       14
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300042256"
     variation       15
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016114973"
     variation       16
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961427109"
     variation       25
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565169904"
     variation       26
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992899584"
     variation       31
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283602997"
     variation       32..50
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ctcgggctgggctcgggct"
                     /replace="ctcgggctgggctcgggctgggctcgggct"
                     /db_xref="dbSNP:1222163710"
     variation       34
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917279065"
     variation       45
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218630104"
     variation       50
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289491525"
     variation       52..64
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cgggggcggcgtc"
                     /db_xref="dbSNP:1490145425"
     variation       52
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569433077"
     variation       53..57
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1199845416"
     variation       54
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:948699597"
     variation       55
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533411359"
     variation       57
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1407999005"
     variation       64
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420335665"
     variation       65
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161045000"
     variation       66
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364220249"
     variation       70
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372021497"
     variation       77
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438821605"
     variation       79
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277886808"
     variation       80
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350098471"
     variation       87
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1351869950"
     variation       89
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768518081"
     variation       90
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270640642"
     variation       92
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333243632"
     variation       95
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:550150837"
     variation       96
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273213014"
     variation       99..105
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ccaacca"
                     /replace="ccaaccaacca"
                     /db_xref="dbSNP:1558537371"
     variation       99
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1242406789"
     variation       102
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312889365"
     CDS             105..4436
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /codon_start=1
                     /product="receptor-type tyrosine-protein phosphatase U
                     isoform X3"
                     /protein_id="XP_016855483.1"
                     /db_xref="GeneID:10076"
                     /db_xref="HGNC:HGNC:9683"
                     /db_xref="MIM:602454"
                     /translation="
MARAQALVLALTFQLCAPETETPAAGCTFEEASDPAVPCEYSQAQYDDFQWEQVRIHPGTRAPADLPHGSYLMVNTSQHAPGQRAHVIFQSLSENDTHCVQFSYFLYSRDGHSPGTLGVYVRVNGGPLGSAVWNMTGSHGRQWHQAELAVSTFWPNEYQVLFEALISPDRRGYMGLDDILLLSYPCAKAPHFSRLGDVEVNAGQNASFQCMAAGRAAEAERFLLQRQSGALVPAAGVRHISHRRFLATFPLAAVSRAEQDLYRCVSQAPRGAGVSNFAELIVKEPPTPIAPPQLLRAGPTYLIIQLNTNSIIGDGPIVRKEIEYRMARGPWAEVHAVSLQTYKLWHLDPDTEYEISVLLTRPGDGGTGRPGPPLISRTKCAEPMRAPKGLAFAEIQARQLTLQWEPLGYNVTRCHTYTVSLCYHYTLGSSHNQTIRECVKTEQGVSRYTIKNLLPYRNVHVRLVLTNPEGRKEGKEVTFQTDEDVPSGIAAESLTFTPLEDMIFLKWEEPQEPNGLITQYEISYQSIESSDPAVNVPGPRRTISKLRNETYHVFSNLHPGTTYLFSVRARTGKGFGQAALTEITTNISAPSFDYADMPSPLGESENTITVLLRPAQGRGAPISVYQVIVEEERARRLRREPGGQDCFPVPLTFEAALARGLVHYFGAELAASSLPEAMPFTVGDNQTYRGFWNPPLEPRKAYLIYFQAASHLKGETRLNCIRIARKAACKESKRPLEVSQRSEEMGLILGICAGGLAVLILLLGAIIVIIRKGRDHYAYSYYPKPVNMTKATVNYRQEKTHMMSAVDRSFTDQSTLQEDERLGLSFMDTHGYSTRGDQRSGGVTEASSLLGGSPRRPCGRKGSPYHTGQLHPAVRVADLLQHINQMKTAEGYGFKQEYESFFEGWDATKKKDKVKGSRQEPMPAYDRHRVKLHPMLGDPNADYINANYIDGYHRSNHFIATQGPKPEMVYDFWRMVWQEHCSSIVMITKLVEVKCSRYWPEDSDTYGDIKIMLVKTETLAEYVVRTFALERRGYSARHEVRQFHFTAWPEHGVPYHATGLLAFIRRVKASTPPDAGPIVIHCSAGTGRTGCYIVLDVMLDMAECEGVVDIYNCVKTLCSRRVNMIQTEEQYIFIHDAILEACLCGETTIPVSEFKATYKEMIRIDPQSNSSQLREEFQTLNSVTPPLDVEECSIALLPRNRDKNRSMDVLPPDRCLPFLISTDGDSNNYINAALTDSYTRSAAFIVTLHPLQSTTPDFWRLVYDYGCTSIVMLNQLNQSNSAWPCLQYWPEPGRQQYGLMEVEFMSGTADEDLVARVFRVQNISRLQEGHLLVRHFQFLRWSAYRDTPDSKKAFLHLLAEVDKWQAESGDGRTIVHCLNGGGRSGTFCACATVLEMIRCHNLVDVFFAAKTLRNYKPNMVETMDQYHFCYDVALEYLEGLESR"
     variation       105
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253967705"
     variation       110
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337643532"
     variation       111
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:570172140"
     variation       118
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222988190"
     variation       120
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769484139"
     variation       125
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772848450"
     variation       126
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470248239"
     variation       128
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435726159"
     variation       133
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203444864"
     variation       134
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183706725"
     variation       136
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415590704"
     variation       137
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030248164"
     variation       139
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460807393"
     variation       147
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441045363"
     variation       151
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762456884"
     variation       152
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891293783"
     variation       158
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574582482"
     variation       162
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181188224"
     variation       177
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396363547"
     variation       181
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913909960"
     variation       183
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747950055"
     variation       187
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211803591"
     variation       188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200999797"
     variation       191
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566894902"
     variation       194
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485089113"
     variation       200
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210967254"
     variation       202
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258263880"
     variation       206
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748891901"
     variation       209
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770459736"
     variation       210..221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gc"
                     /replace="gcagtgccctgc"
                     /db_xref="dbSNP:1192937797"
     variation       210
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773778550"
     variation       214
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759068060"
     variation       215
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945425797"
     variation       216
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170767117"
     variation       219
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393487236"
     variation       221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377643230"
     variation       222
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776058651"
     variation       224
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405003538"
     variation       229
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380977711"
     variation       232
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:901800031"
     variation       234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761123118"
     variation       236
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764491433"
     variation       238
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754130407"
     variation       242
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300881491"
     variation       243
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757514459"
     variation       248
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358151903"
     variation       251
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234392495"
     variation       252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418548789"
     variation       253
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997349584"
     variation       260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558551779"
     variation       267
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146941816"
     variation       272
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750516439"
     variation       273
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758489629"
     variation       274
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574614506"
     variation       275
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780997351"
     variation       276
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371317476"
     variation       277
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262311571"
     variation       278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338371511"
     variation       279
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755926852"
     variation       280
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777504835"
     variation       282
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574614572"
     variation       283
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35332573"
     variation       284
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909776587"
     variation       285
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148144154"
     variation       286
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138921680"
     variation       287
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379406507"
     variation       289
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745439085"
     variation       290
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574614641"
     variation       295
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199954695"
     variation       296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775871361"
     variation       304
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761211287"
     variation       308
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764581026"
     variation       309
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777175459"
     variation       310
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231340538"
     variation       311
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292565882"
     variation       318
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008468953"
     variation       321
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1189724023"
     variation       326
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146315626"
     variation       328
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310240713"
     variation       329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223479339"
     variation       334
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769336407"
     variation       335
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399753573"
     variation       339
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377424434"
     variation       343..346
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cc"
                     /replace="cccc"
                     /db_xref="dbSNP:774156695"
     variation       345
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041286420"
     variation       349
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252572464"
     variation       354
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777263174"
     variation       355
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762333443"
     variation       357
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564556096"
     variation       358
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273937859"
     variation       360
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773331062"
     variation       361
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167265643"
     variation       362
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342794248"
     variation       363
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370446021"
     variation       366
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202220903"
     variation       380
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574619824"
     variation       381
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308141165"
     variation       382
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751690828"
     variation       383
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412360182"
     variation       384
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182130635"
     variation       390
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769283632"
     variation       391
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397594638"
     variation       392
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189532318"
     variation       402
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447229400"
     variation       403
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764087712"
     variation       410
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753710925"
     variation       416
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757013273"
     variation       420
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778718869"
     variation       422
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35221174"
     variation       425
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275591773"
     variation       428
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574619952"
     variation       429
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142872520"
     variation       430
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746575215"
     variation       434
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144272817"
     variation       435
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781765403"
     variation       436
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748617345"
     variation       437
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303749627"
     variation       440
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558554276"
     variation       442
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1417761202"
     variation       445
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958139724"
     variation       448
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168892771"
     variation       449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391618357"
     variation       453
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770088302"
     variation       455
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012519466"
     variation       456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773666732"
     variation       458
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023413155"
     variation       459
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763206125"
     variation       462
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286935680"
     variation       464
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771245838"
     variation       465
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774555578"
     variation       468
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759619380"
     variation       469
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767531061"
     variation       470
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151193356"
     variation       471
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761766129"
     variation       479
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745553611"
     variation       482
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181518033"
     variation       483
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262463311"
     variation       484
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145285047"
     variation       487
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1188841752"
     variation       487
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485779400"
     variation       489
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189608960"
     variation       500
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249514459"
     variation       504
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758114632"
     variation       508
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172504132"
     variation       514
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766199196"
     variation       516
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751189045"
     variation       518
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754559435"
     variation       520
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549250970"
     variation       521
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766339466"
     variation       522
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145487041"
     variation       525
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749732181"
     variation       526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202137599"
     variation       533
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558554534"
     variation       534
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774573641"
     variation       538
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1433023719"
     variation       543
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273106178"
     variation       549
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374109095"
     variation       552
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385013977"
     variation       557
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384492245"
     variation       566
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991644312"
     variation       570
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916033137"
     variation       571
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776959435"
     variation       573
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772168315"
     variation       575
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760645248"
     variation       579
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209767452"
     variation       580
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270365334"
     variation       582
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163560133"
     variation       587
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367800470"
     variation       594
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414818070"
     variation       595
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762761318"
     variation       599
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326970997"
     variation       600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370078668"
     variation       604
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410496436"
     variation       606
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766389325"
     variation       607
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774336409"
     variation       609
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149193602"
     variation       610
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027959399"
     variation       612
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200344921"
     variation       613
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752228030"
     variation       614
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358064137"
     variation       615
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212481491"
     variation       616
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763466268"
     variation       622
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1483129819"
     variation       624..634
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="atgggcctaga"
                     /db_xref="dbSNP:759599853"
     variation       624
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754397053"
     variation       629
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757798795"
     variation       630
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558555462"
     variation       634
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372533443"
     variation       635
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557988451"
     variation       638
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758756864"
     variation       642
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529262147"
     variation       644
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039518217"
     variation       647
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167005051"
     variation       648
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531528981"
     variation       650
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:899633203"
     variation       653
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747140772"
     variation       655
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574621573"
     variation       656
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170501003"
     variation       657
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374191788"
     variation       659
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156633017"
     variation       662
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395916535"
     variation       664
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158934133"
     variation       668
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768248717"
     variation       669
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:928077971"
     variation       672
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291493083"
     variation       674
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776339059"
     variation       677
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761315904"
     variation       680
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302695461"
     variation       682
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306642026"
     variation       684
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551327796"
     variation       685
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764668369"
     variation       687
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227748160"
     variation       689
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1288884022"
     variation       690
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331019357"
     variation       692
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211584653"
     variation       693
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263905748"
     variation       695
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773730619"
     variation       696
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763409445"
     variation       697
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368441060"
     variation       698..699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gg"
                     /replace="gggg"
                     /db_xref="dbSNP:1558555881"
     variation       705
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956120990"
     variation       707
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751927235"
     variation       708
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755366630"
     variation       709
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182157574"
     variation       710
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767639102"
     variation       713
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200897691"
     variation       715
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1163046887"
     variation       718
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995037090"
     variation       719
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370586274"
     variation       720
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574622135"
     variation       721
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943968406"
     variation       724
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749351848"
     variation       725
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758312812"
     variation       728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199659873"
     variation       730
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253667116"
     variation       731
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746844327"
     variation       732
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427055107"
     variation       735
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768428101"
     variation       736
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226411927"
     variation       737
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386550406"
     variation       740
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200141717"
     variation       741
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374665975"
     variation       743
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245853977"
     variation       746
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:550684997"
     variation       747
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769324716"
     variation       750
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204523221"
     variation       751
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772758454"
     variation       752
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462845233"
     variation       753
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484292162"
     variation       755
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766864462"
     variation       758
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300216875"
     variation       761
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774856384"
     variation       765
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759835384"
     variation       766
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166541622"
     variation       768
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387930794"
     variation       770
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226142479"
     variation       773
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273866381"
     variation       774
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767876425"
     variation       776
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753003854"
     variation       782
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960700973"
     variation       789..794
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="ggggcg"
                     /db_xref="dbSNP:1165372311"
     variation       789
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156815145"
     variation       791
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538219831"
     variation       793
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:919388670"
     variation       794
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548077175"
     variation       798
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347115415"
     variation       803
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557033794"
     variation       805
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274282332"
     variation       806
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761809526"
     variation       810
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225932590"
     variation       811
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286979969"
     variation       813
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328977682"
     variation       815
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1128404"
     variation       816
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285923055"
     variation       818
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449462238"
     variation       820
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1382855447"
     variation       822
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220220016"
     variation       825
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1246821060"
     variation       826
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490690017"
     variation       828
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247393831"
     variation       829
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179993182"
     variation       831
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952747316"
     variation       832
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337958962"
     variation       833
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411139430"
     variation       842
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984027835"
     variation       844
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472797273"
     variation       852
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751482726"
     variation       853
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754982172"
     variation       854
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403776241"
     variation       855
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1242664616"
     variation       860
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323107736"
     variation       864
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:908394240"
     variation       869
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350590032"
     variation       871
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406832445"
     variation       872
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961223834"
     variation       873
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1306794834"
     variation       874
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350338168"
     variation       875
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992652178"
     variation       876
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281590782"
     variation       878
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574623561"
     variation       883
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353863394"
     variation       884
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781094419"
     variation       887
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398347328"
     variation       891
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:865958402"
     variation       892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290127372"
     variation       896
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1361055439"
     variation       896
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1202317765"
     variation       897
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251002508"
     variation       901
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412449815"
     variation       902
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752555763"
     variation       905
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251629393"
     variation       906
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755841875"
     variation       908
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948456510"
     variation       910
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235554961"
     variation       911
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777417954"
     variation       913
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1294698431"
     variation       914
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162903801"
     variation       916
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386018858"
     variation       917
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200792915"
     variation       923
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166778807"
     variation       924
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271200096"
     variation       926
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1370532155"
     variation       928
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341883965"
     variation       933
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770382407"
     variation       935
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778529151"
     variation       937
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339095569"
     variation       938
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461905390"
     variation       945
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943144836"
     variation       947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543166825"
     variation       948
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384529121"
     variation       949
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225614805"
     variation       950
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273243204"
     variation       951
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776131609"
     variation       952
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197506479"
     variation       956
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301122115"
     variation       963
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148349447"
     variation       973
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775440824"
     variation       974
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557045961"
     variation       975
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763919581"
     variation       976
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200088829"
     variation       979..982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="caca"
                     /replace="cacaca"
                     /db_xref="dbSNP:1326826823"
     variation       981
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227555601"
     variation       983
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368989564"
     variation       990
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764943961"
     variation       991
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77846932"
     variation       993
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373682109"
     variation       994
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222720443"
     variation       998
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451060079"
     variation       1001
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202132621"
     variation       1003
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988442037"
     variation       1010
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369094441"
     variation       1016
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471852569"
     variation       1018
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558557865"
     variation       1020
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290092044"
     variation       1027
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746485300"
     variation       1034..1039
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1553365272"
     variation       1037
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364063585"
     variation       1039
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454991503"
     variation       1043
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161050516"
     variation       1044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389411627"
     variation       1047
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755590386"
     variation       1051
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200535287"
     variation       1052
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775160621"
     variation       1053
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769995940"
     variation       1054
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409040942"
     variation       1055
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773507256"
     variation       1057
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318464490"
     variation       1060
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241477456"
     variation       1062
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1263845459"
     variation       1064
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355735436"
     variation       1066
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223313718"
     variation       1068
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749473209"
     variation       1071
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760439143"
     variation       1073
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774465671"
     variation       1074
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:989135088"
     variation       1075
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558558014"
     variation       1076
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408787926"
     variation       1077
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759602878"
     variation       1078
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764162839"
     variation       1080
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184974004"
     variation       1081
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367530117"
     variation       1083
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776361366"
     variation       1085
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202200992"
     variation       1086
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368676485"
     variation       1088
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429066456"
     variation       1089
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150643953"
     variation       1091
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573346927"
     variation       1094
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766106101"
     variation       1099
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751172417"
     variation       1104
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574625378"
     variation       1109
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296479585"
     variation       1110
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754379288"
     variation       1112
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279687694"
     variation       1114
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781729728"
     variation       1117
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545730447"
     variation       1127
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756535014"
     variation       1130
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205098380"
     variation       1132
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749634298"
     variation       1133
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771203901"
     variation       1138
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180471157"
     variation       1141
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200476689"
     variation       1142
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313581246"
     variation       1143
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255107727"
     variation       1145
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359275159"
     variation       1151
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444836766"
     variation       1156
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779106598"
     variation       1157
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210809400"
     variation       1160
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387808622"
     variation       1164
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745948916"
     variation       1167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1171067110"
     variation       1171
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356203293"
     variation       1172
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464407458"
     variation       1173
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771984879"
     variation       1178
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405678043"
     variation       1181
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201004806"
     variation       1183
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233567141"
     variation       1184
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373684691"
     variation       1185
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363128217"
     variation       1190
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769737368"
     variation       1192
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773188953"
     variation       1193
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762826676"
     variation       1195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766201050"
     variation       1196
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115945321"
     variation       1199
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445096904"
     variation       1204
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759109068"
     variation       1209
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262946601"
     variation       1211
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909300661"
     variation       1214
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574625683"
     variation       1220
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574625687"
     variation       1222
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462009974"
     variation       1224
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205189686"
     variation       1229
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766899103"
     variation       1231
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574625715"
     variation       1234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464102140"
     variation       1235
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231844513"
     variation       1237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752222290"
     variation       1240
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72649292"
     variation       1244
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1431337609"
     variation       1245
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175217686"
     variation       1247
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778243643"
     variation       1252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770800809"
     variation       1254
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774180157"
     variation       1255
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959632213"
     variation       1256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567419585"
     variation       1258
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286812917"
     variation       1260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767178701"
     variation       1261
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557437634"
     variation       1262
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142038734"
     variation       1263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764593080"
     variation       1267
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992386548"
     variation       1275
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917943637"
     variation       1279
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319405195"
     variation       1284
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278076410"
     variation       1290
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221081715"
     variation       1291
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754281839"
     variation       1292
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461837314"
     variation       1294
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757637278"
     variation       1296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199598502"
     variation       1297
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188935262"
     variation       1300
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112655463"
     variation       1304
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758595009"
     variation       1308
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764152404"
     variation       1312
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410433594"
     variation       1317
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201530682"
     variation       1320
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753860935"
     variation       1322
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366778445"
     variation       1323
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749198271"
     variation       1333
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476871993"
     variation       1334
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112126003"
     variation       1339
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750632643"
     variation       1340
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745659997"
     variation       1341
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771686501"
     variation       1342
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775138343"
     variation       1350
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244663161"
     variation       1356
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407427961"
     variation       1358
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760111768"
     variation       1363
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763550469"
     variation       1364
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777157836"
     variation       1367
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272123342"
     variation       1370
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762350700"
     variation       1371
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206343055"
     variation       1372
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234861418"
     variation       1374
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442972080"
     variation       1375
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574648166"
     variation       1377
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765712745"
     variation       1380
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750813678"
     variation       1384
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758786587"
     variation       1387
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972529303"
     variation       1390
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396401370"
     variation       1394
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:534838486"
     variation       1395
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751746624"
     variation       1399
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755139125"
     variation       1402..1404
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:754474692"
     variation       1407
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781460636"
     variation       1408
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1384371565"
     variation       1410
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748214576"
     variation       1411
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757320195"
     variation       1416
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1339969438"
     variation       1419
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778902967"
     variation       1423
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949821700"
     variation       1434
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111456945"
     variation       1435
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745651327"
     variation       1439
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434690559"
     variation       1443
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557784273"
     variation       1444
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775032590"
     variation       1449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746629081"
     variation       1452
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045863349"
     variation       1454
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191094158"
     variation       1458
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373055373"
     variation       1471
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768269652"
     variation       1472
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371453562"
     variation       1473
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145823140"
     variation       1474
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761301664"
     variation       1476
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571821576"
     variation       1477
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936964613"
     variation       1478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758999072"
     variation       1479
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537215101"
     variation       1480
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766726685"
     variation       1484
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751838866"
     variation       1485
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759884380"
     variation       1489
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229548485"
     variation       1490
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453745616"
     variation       1500
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752889478"
     variation       1501
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159666780"
     variation       1502
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1387690496"
     variation       1514
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756193219"
     variation       1515
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054752703"
     variation       1516..1528
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gcaa"
                     /replace="gcaaagagggcaa"
                     /db_xref="dbSNP:780541187"
     variation       1516
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35745442"
     variation       1517
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406991274"
     variation       1521
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758163416"
     variation       1523
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779943702"
     variation       1524
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285689403"
     variation       1526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746786939"
     variation       1531
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768357603"
     variation       1532
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780820227"
     variation       1533
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574648595"
     variation       1542
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195964957"
     variation       1544
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747663497"
     variation       1546
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574283151"
     variation       1547
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773615087"
     variation       1552
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354103352"
     variation       1553
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763555638"
     variation       1559
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390604943"
     variation       1560
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780836731"
     variation       1562
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747750799"
     variation       1567
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241329233"
     variation       1572
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313050728"
     variation       1574
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358754416"
     variation       1575
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533690295"
     variation       1577
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35932909"
     variation       1578
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756633219"
     variation       1589
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200502248"
     variation       1596
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774929231"
     variation       1598
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759990211"
     variation       1599
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772512200"
     variation       1600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384089441"
     variation       1602
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444645432"
     variation       1604
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165471806"
     variation       1608
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352680476"
     variation       1613
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461338949"
     variation       1630
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775882102"
     variation       1634
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148293511"
     variation       1636
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907538668"
     variation       1645
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764204163"
     variation       1647
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776833843"
     variation       1650
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761797398"
     variation       1657
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150842094"
     variation       1661
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306243879"
     variation       1663
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227202193"
     variation       1664
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252285913"
     variation       1668
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907609500"
     variation       1671
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776652943"
     variation       1676
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761968272"
     variation       1677
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485227658"
     variation       1679
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143580709"
     variation       1681
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557442149"
     variation       1685
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774304347"
     variation       1686
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746633101"
     variation       1699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373947377"
     variation       1700
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146208154"
     variation       1704
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470441876"
     variation       1709
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199754745"
     variation       1710
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201821547"
     variation       1713
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753380680"
     variation       1723
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371266065"
     variation       1725
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756818305"
     variation       1726
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403532640"
     variation       1728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919785307"
     variation       1733
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1317834071"
     variation       1738
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778603022"
     variation       1739
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346492375"
     variation       1743
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769242189"
     variation       1744
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370694990"
     variation       1747
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144456016"
     variation       1751
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215865672"
     variation       1752
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574653734"
     variation       1754
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200125249"
     variation       1769
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257061844"
     variation       1771
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141637360"
     variation       1772
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747407994"
     variation       1776
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768845768"
     variation       1777
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776936599"
     variation       1779
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748279144"
     variation       1787
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769972938"
     variation       1788
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191556392"
     variation       1789
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142576020"
     variation       1796
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574653792"
     variation       1799
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478100294"
     variation       1802
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140670427"
     variation       1803
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375192977"
     variation       1806
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406049775"
     variation       1807
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418631649"
     variation       1812
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183165721"
     variation       1813
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775231191"
     variation       1816
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368514487"
     variation       1817
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943913977"
     variation       1818..1819
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:989244820"
     variation       1818
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040734490"
     variation       1820
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:117122029"
     variation       1825
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574653890"
     variation       1829
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187052302"
     variation       1830
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277468526"
     variation       1835
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372130058"
     variation       1836
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557442517"
     variation       1837
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150267021"
     variation       1838
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750023335"
     variation       1841
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757917846"
     variation       1842
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350317572"
     variation       1844
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780625689"
     variation       1847
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292407071"
     variation       1851
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751964101"
     variation       1858
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202158845"
     variation       1862
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200865092"
     variation       1863
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376299815"
     variation       1874
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753064744"
     variation       1877
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756411267"
     variation       1878
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367633133"
     variation       1880
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574654553"
     variation       1888
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764564395"
     variation       1889
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371739078"
     variation       1890
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771105941"
     variation       1892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:960537450"
     variation       1897
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754296328"
     variation       1898
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745951491"
     variation       1901
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574654619"
     variation       1902
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341692539"
     variation       1910
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428571913"
     variation       1914
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269460155"
     variation       1919
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003151860"
     variation       1921
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314818938"
     variation       1922
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768547107"
     variation       1931
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148921515"
     variation       1932
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747973212"
     variation       1934
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769664316"
     variation       1937
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897198194"
     variation       1945
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202066264"
     variation       1946
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201241001"
     variation       1947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217243583"
     variation       1954
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444144728"
     variation       1956
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369488427"
     variation       1957
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766033489"
     variation       1958
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773799165"
     variation       1959
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283282681"
     variation       1963
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138353108"
     variation       1964
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767921472"
     variation       1968
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753152609"
     variation       1976
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333021035"
     variation       1982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761217742"
     variation       1988
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764568294"
     variation       1991
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147204318"
     variation       2001
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757579431"
     variation       2002
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141378439"
     variation       2005
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758440077"
     variation       2006
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780322316"
     variation       2007
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373382555"
     variation       2008
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756178981"
     variation       2016
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429802390"
     variation       2017
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139042764"
     variation       2019
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380386412"
     variation       2020
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440930100"
     variation       2021
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201851473"
     variation       2022
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384517700"
     variation       2026
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045451"
     variation       2029
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341395655"
     variation       2033
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376493752"
     variation       2036
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458259120"
     variation       2038
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1268603319"
     variation       2039
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552985364"
     variation       2045
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574658455"
     variation       2046
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394004581"
     variation       2048
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778460941"
     variation       2052
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557445996"
     variation       2054
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80072461"
     variation       2055
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368857411"
     variation       2057
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042591455"
     variation       2059
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313619915"
     variation       2060
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775035994"
     variation       2063
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760171185"
     variation       2064
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769159207"
     variation       2068
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762111865"
     variation       2069
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765600568"
     variation       2071
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238402323"
     variation       2073
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143248099"
     variation       2079
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763284942"
     variation       2080
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241945183"
     variation       2083..2091
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gc"
                     /replace="gcctggtgc"
                     /db_xref="dbSNP:1424353093"
     variation       2083
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449618455"
     variation       2088
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372566755"
     variation       2090
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447456728"
     variation       2092
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371134020"
     variation       2093
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461294257"
     variation       2095
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170313181"
     variation       2097
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751757583"
     variation       2099
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148761398"
     variation       2100
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334824831"
     variation       2102..2113
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ggccgaactggc"
                     /replace="ggccgaactggccgaactggc"
                     /db_xref="dbSNP:1378462162"
     variation       2102
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777872587"
     variation       2105
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535081694"
     variation       2106
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325119356"
     variation       2111..2112
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1173860235"
     variation       2112
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151313946"
     variation       2113
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147046605"
     variation       2114
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142462225"
     variation       2115
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201336587"
     variation       2119
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779619206"
     variation       2121
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746539126"
     variation       2123
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318851717"
     variation       2128
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386342627"
     variation       2130
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768110231"
     variation       2135
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364723313"
     variation       2141
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436019907"
     variation       2145
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752265933"
     variation       2147
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762423778"
     variation       2155
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574658774"
     variation       2163
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770180060"
     variation       2165
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425451005"
     variation       2170
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467399917"
     variation       2177
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310482041"
     variation       2182
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574658814"
     variation       2183
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370713276"
     variation       2187
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441993616"
     variation       2188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174468524"
     variation       2190
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773685454"
     variation       2191
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937518889"
     variation       2193..2202
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="gagcctagga"
                     /db_xref="dbSNP:1466612901"
     variation       2194
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305171137"
     variation       2195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346931110"
     variation       2205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763224105"
     variation       2207
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1004912917"
     variation       2216
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766721153"
     variation       2222
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751780427"
     variation       2225
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199827632"
     variation       2229
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221308050"
     variation       2237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560820818"
     variation       2242
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300162481"
     variation       2243
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312328083"
     variation       2244
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767744520"
     variation       2246
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258935881"
     variation       2252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423180895"
     variation       2254
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780706633"
     variation       2260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747699412"
     variation       2265
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755529253"
     variation       2266
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370746849"
     variation       2268
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749851774"
     variation       2271
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446862039"
     variation       2278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771540763"
     variation       2279
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894210397"
     variation       2291
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371492891"
     variation       2300
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384295445"
     variation       2302
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557448747"
     variation       2303
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759261859"
     variation       2304
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767213601"
     variation       2305
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752250395"
     variation       2307
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763820625"
     variation       2311
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1256447461"
     variation       2313
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454232372"
     variation       2314
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320192334"
     variation       2318
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343481840"
     variation       2321
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190089304"
     variation       2323
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753385501"
     variation       2327
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757903277"
     variation       2329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770336069"
     variation       2330
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779491423"
     variation       2337
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746246072"
     variation       2340
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474004669"
     variation       2342
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772273324"
     variation       2343
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026420879"
     variation       2361
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911884696"
     variation       2362
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753493867"
     variation       2364..2369
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:764235465"
     variation       2374
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780357940"
     variation       2380..2415
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="tcatcc"
                     /replace="tcatccttctcctgggtgccatcattgtcatcatcc"
                     /db_xref="dbSNP:1172300112"
     variation       2381
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544754887"
     variation       2384
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768904318"
     variation       2388
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1337595138"
     variation       2389
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776750652"
     variation       2390
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269986653"
     variation       2393
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041823673"
     variation       2403..2405
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="att"
                     /db_xref="dbSNP:1360798473"
     variation       2404
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1557449027"
     variation       2409
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428508088"
     variation       2410
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138841821"
     variation       2414
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770860645"
     variation       2415
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774218458"
     variation       2416
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780379580"
     variation       2421
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343028764"
     variation       2423
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333431120"
     variation       2427
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213354415"
     variation       2428
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401183959"
     variation       2429
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446283633"
     variation       2430
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488850406"
     variation       2434
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772032499"
     variation       2435
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219210912"
     variation       2441
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265663818"
     variation       2449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1450709407"
     variation       2450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775214710"
     variation       2452
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199905412"
     variation       2456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393655779"
     variation       2458
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311206945"
     variation       2459
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116098859"
     variation       2461
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775437270"
     variation       2465
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746799427"
     variation       2466
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768529236"
     variation       2467
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197564184"
     variation       2478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527888616"
     variation       2479..2480
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:754075527"
     variation       2480
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761609935"
     variation       2481
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376574571"
     variation       2485
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255358253"
     variation       2489
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424220050"
     variation       2490
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305540982"
     variation       2491
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772668777"
     variation       2492
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141786387"
     variation       2494..2498
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1476973794"
     variation       2494
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170159718"
     variation       2501
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766810211"
     variation       2502
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463582375"
     variation       2508
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891552255"
     variation       2510
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188432284"
     variation       2512
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752058506"
     variation       2513
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755369010"
     variation       2514
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:928388049"
     variation       2515
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767916161"
     variation       2516
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41302038"
     variation       2517
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217637863"
     variation       2519
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777985162"
     variation       2520
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749337965"
     variation       2521
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1207375816"
     variation       2522
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757309879"
     variation       2526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140574807"
     variation       2529
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747005244"
     variation       2536
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768694899"
     variation       2540
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776629496"
     variation       2542
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150111261"
     variation       2543
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424574176"
     variation       2548
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430417219"
     variation       2550
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362201750"
     variation       2556
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975023279"
     variation       2557
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769574394"
     variation       2558
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772864093"
     variation       2560
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534134393"
     variation       2561
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553764781"
     variation       2562
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149813959"
     variation       2564
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760091774"
     variation       2565
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768006172"
     variation       2566
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377692219"
     variation       2568
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760966655"
     variation       2572
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218017975"
     variation       2580
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371247916"
     variation       2582
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757388180"
     variation       2584
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779101252"
     variation       2586
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992641599"
     variation       2588
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283786188"
     variation       2590..2594
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="cccat"
                     /db_xref="dbSNP:762188899"
     variation       2590
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755036701"
     variation       2593
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374736449"
     variation       2595
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486983260"
     variation       2599
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200968040"
     variation       2602
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312405083"
     variation       2607
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558954146"
     variation       2608
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769583142"
     variation       2609
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777323857"
     variation       2614
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776818962"
     variation       2615
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557468958"
     variation       2616
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961932649"
     variation       2619
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148597380"
     variation       2624
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771530684"
     variation       2625
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147675664"
     variation       2626
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866352816"
     variation       2631
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61729921"
     variation       2635..2636
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:750843953"
     variation       2639
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140494175"
     variation       2641
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215725115"
     variation       2645
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377277838"
     variation       2652
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762018068"
     variation       2654
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205903828"
     variation       2657
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765510662"
     variation       2660
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472040056"
     variation       2661
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181666474"
     variation       2663
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773522864"
     variation       2665
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559788899"
     variation       2666
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532193157"
     variation       2667
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751669884"
     variation       2669
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756140634"
     variation       2670
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763868325"
     variation       2671
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201570633"
     variation       2672
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447139102"
     variation       2676
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931150960"
     variation       2677
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756949812"
     variation       2681..2682
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1217465879"
     variation       2682
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149545916"
     variation       2683
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200085066"
     variation       2685
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886893455"
     variation       2688
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758023346"
     variation       2689
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213987537"
     variation       2696
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779595048"
     variation       2697
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746498953"
     variation       2699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2295061"
     variation       2704
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146215972"
     variation       2705
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748568462"
     variation       2707
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770246947"
     variation       2708
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141680370"
     variation       2710
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763319341"
     variation       2711
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766702671"
     variation       2715
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475479461"
     variation       2719
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867877309"
     variation       2720
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200605710"
     variation       2722
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139349633"
     variation       2723
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764110764"
     variation       2727
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144662614"
     variation       2728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757186665"
     variation       2730
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765064227"
     variation       2732
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199628688"
     variation       2733
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145708690"
     variation       2735
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015163733"
     variation       2738
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150988287"
     variation       2741
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754397567"
     variation       2744
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369052583"
     variation       2751
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219231376"
     variation       2755
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748647049"
     variation       2756
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770406013"
     variation       2760
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778343280"
     variation       2767
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140979819"
     variation       2768
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771289142"
     variation       2771
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138733986"
     variation       2772
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775082864"
     variation       2774
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974675542"
     variation       2776
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538867374"
     variation       2780
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137880682"
     variation       2781
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765153873"
     variation       2782
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259656755"
     variation       2786
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417738957"
     variation       2788
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157846379"
     variation       2789
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162830128"
     variation       2791
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372659114"
     variation       2792
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143923802"
     variation       2793
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983956280"
     variation       2795
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750225213"
     variation       2796
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574698224"
     variation       2798
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61733825"
     variation       2815
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746238347"
     variation       2821
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186476406"
     variation       2822
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147297333"
     variation       2823
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747115361"
     variation       2831
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768683126"
     variation       2843
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910621599"
     variation       2844
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371079414"
     variation       2846
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943227611"
     variation       2847
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776661016"
     variation       2848
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749275440"
     variation       2856
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150833997"
     variation       2857
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774083255"
     variation       2858
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139236311"
     variation       2860
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393594057"
     variation       2865
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424485822"
     variation       2867
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767095595"
     variation       2868
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438142081"
     variation       2871
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004920455"
     variation       2876
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372729717"
     variation       2877
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384466759"
     variation       2883
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761326912"
     variation       2884
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140091385"
     variation       2889
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750903519"
     variation       2890
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758801155"
     variation       2892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766779244"
     variation       2901
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751911543"
     variation       2903
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755264582"
     variation       2904
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200655838"
     variation       2905
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1384533750"
     variation       2906
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781326938"
     variation       2909
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557471353"
     variation       2912
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141019104"
     variation       2918..2921
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1236327092"
     variation       2918
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257684797"
     variation       2919
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283621509"
     variation       2920
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370440569"
     variation       2922
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771478825"
     variation       2923
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2235937"
     variation       2924
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771889225"
     variation       2925
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266062665"
     variation       2927
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374111722"
     variation       2928
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143594487"
     variation       2935
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768435626"
     variation       2940
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776375990"
     variation       2942
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761261976"
     variation       2944
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769386710"
     variation       2949
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772574986"
     variation       2950
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763576226"
     variation       2952
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200069574"
     variation       2956
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776458421"
     variation       2960..2961
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1373092912"
     variation       2960
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775811963"
     variation       2965
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532350399"
     variation       2966
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470817827"
     variation       2974
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322664537"
     variation       2982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392298851"
     variation       2983
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768943590"
     variation       2984..2989
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cactca"
                     /replace="cactcactca"
                     /db_xref="dbSNP:1557477459"
     variation       2989
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777032680"
     variation       2992
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429105024"
     variation       2995
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779614135"
     variation       2996
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979844649"
     variation       3007
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542124199"
     variation       3008
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760591977"
     variation       3009
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201669618"
     variation       3012
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439328311"
     variation       3013
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374287280"
     variation       3015
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375440765"
     variation       3016
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005837484"
     variation       3024
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761545000"
     variation       3025
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746543812"
     variation       3026
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750114977"
     variation       3027
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1167829205"
     variation       3032
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758047679"
     variation       3036
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918059398"
     variation       3039
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412025858"
     variation       3040
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201177009"
     variation       3042
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751077674"
     variation       3043
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414960537"
     variation       3044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015417936"
     variation       3049
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773694835"
     variation       3050
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770246925"
     variation       3051
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349481834"
     variation       3052
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226679567"
     variation       3054
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251795647"
     variation       3056
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140673849"
     variation       3057
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138769148"
     variation       3058
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310201143"
     variation       3060
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199881617"
     variation       3061
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200884886"
     variation       3062
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188918106"
     variation       3068
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258424459"
     variation       3071
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942000483"
     variation       3072
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745899276"
     variation       3077
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768601463"
     variation       3078
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761708200"
     variation       3080
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423397329"
     variation       3083
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395868747"
     variation       3084
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759237592"
     variation       3087
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767188478"
     variation       3091
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322336610"
     variation       3093
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040440432"
     variation       3094
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752247574"
     variation       3103
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315362007"
     variation       3104
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372277693"
     variation       3105
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764636241"
     variation       3106
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466300449"
     variation       3110
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212427445"
     variation       3116
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754172833"
     variation       3122
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142752020"
     variation       3123
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374948381"
     variation       3124
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557478916"
     variation       3127
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959790909"
     variation       3131
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746150522"
     variation       3133
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992563202"
     variation       3135
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1418213094"
     variation       3140..3150
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="gctggtgaaga"
                     /db_xref="dbSNP:1366372503"
     variation       3141
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159361871"
     variation       3144
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:918097528"
     variation       3145
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568617355"
     variation       3146
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287784590"
     variation       3152
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459385429"
     variation       3153
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780175447"
     variation       3157
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2235940"
     variation       3161
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574713089"
     variation       3167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769738173"
     variation       3168
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216766922"
     variation       3170
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533783853"
     variation       3173
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749070547"
     variation       3174
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770802288"
     variation       3177
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773999258"
     variation       3178
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759323710"
     variation       3179
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574713181"
     variation       3181
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1190514546"
     variation       3188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369911349"
     variation       3191
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760211050"
     variation       3195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764537371"
     variation       3196
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754407171"
     variation       3198
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:778540811"
     variation       3199
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760370694"
     variation       3205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1415337608"
     variation       3206
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768260484"
     variation       3207
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775989929"
     variation       3208
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357886422"
     variation       3211
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762448533"
     variation       3212
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361885848"
     variation       3213
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765597007"
     variation       3214
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547406320"
     variation       3215
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766621505"
     variation       3218
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139230218"
     variation       3219
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375188981"
     variation       3221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443748501"
     variation       3223
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574714963"
     variation       3224
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213067349"
     variation       3225
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781393850"
     variation       3226
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905716408"
     variation       3230
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752718591"
     variation       3236
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144825402"
     variation       3237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310256792"
     variation       3242
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1206527365"
     variation       3244
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778663291"
     variation       3245
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745686767"
     variation       3252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892881427"
     variation       3257
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478494323"
     variation       3260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758306092"
     variation       3261
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201471973"
     variation       3263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019890558"
     variation       3271
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316316599"
     variation       3272
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238331616"
     variation       3277
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768189373"
     variation       3278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776210002"
     variation       3281
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323115388"
     variation       3282
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747555540"
     variation       3284
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112586980"
     variation       3287
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978793043"
     variation       3294
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303045605"
     variation       3296
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773671335"
     variation       3297
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774239929"
     variation       3298
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763421785"
     variation       3299
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370363773"
     variation       3300
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143670953"
     variation       3301
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774688307"
     variation       3302
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759873400"
     variation       3303
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374116935"
     variation       3308
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767573565"
     variation       3309
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216826559"
     variation       3310
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368690546"
     variation       3313
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199318170"
     variation       3317
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756104223"
     variation       3318
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1479166204"
     variation       3319
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569729029"
     variation       3320
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750432345"
     variation       3321
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540458029"
     variation       3322
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574715429"
     variation       3323
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487021838"
     variation       3329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780060079"
     variation       3330
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372756354"
     variation       3333
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423472376"
     variation       3334
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746715574"
     variation       3336
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386652116"
     variation       3338
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:535649188"
     variation       3344
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477115276"
     variation       3345
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780660085"
     variation       3347
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747726088"
     variation       3353
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771446818"
     variation       3354
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753454967"
     variation       3355
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528489064"
     variation       3356
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195031795"
     variation       3359
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275011735"
     variation       3362
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772369273"
     variation       3363
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775907774"
     variation       3366
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760871118"
     variation       3367
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939145772"
     variation       3379
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776864464"
     variation       3383
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139267044"
     variation       3384
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376717923"
     variation       3392
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756829532"
     variation       3393
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192670605"
     variation       3397
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544809605"
     variation       3400
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431312547"
     variation       3404
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767226393"
     variation       3405
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752467292"
     variation       3407
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755828193"
     variation       3409
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777386902"
     variation       3413
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371301025"
     variation       3414
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227491033"
     variation       3422
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34589663"
     variation       3423
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778440993"
     variation       3425
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207625053"
     variation       3426
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746376571"
     variation       3429
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772565654"
     variation       3432
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780351139"
     variation       3433
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747366018"
     variation       3437
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553128890"
     variation       3438..3439
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:745723144"
     variation       3439
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769048566"
     variation       3444
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776960939"
     variation       3451..3456
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:771889038"
     variation       3454
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451683171"
     variation       3455
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172122023"
     variation       3459
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1376740569"
     variation       3462
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867290552"
     variation       3463
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537523993"
     variation       3465
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780002847"
     variation       3466
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773283021"
     variation       3474
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1317151993"
     variation       3478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362544310"
     variation       3479
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759393992"
     variation       3482
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767481420"
     variation       3484
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752489258"
     variation       3491
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331845805"
     variation       3492
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557484030"
     variation       3498
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187844671"
     variation       3507
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419812416"
     variation       3509
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757894378"
     variation       3510
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765767078"
     variation       3511
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752133289"
     variation       3513
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916420886"
     variation       3516
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192610792"
     variation       3519
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166466464"
     variation       3520
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749544640"
     variation       3521
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386926760"
     variation       3529
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374856481"
     variation       3530
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781691616"
     variation       3533
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484354323"
     variation       3536
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182271624"
     variation       3540
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413521106"
     variation       3545
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748515121"
     variation       3546
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965441644"
     variation       3547
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998591082"
     variation       3551
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163959996"
     variation       3555
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350293728"
     variation       3557
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756345416"
     variation       3562
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296187624"
     variation       3563
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1348143409"
     variation       3570
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348880020"
     variation       3579
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778030176"
     variation       3580
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143053196"
     variation       3582
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289140712"
     variation       3589
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141267043"
     variation       3591
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774359775"
     variation       3592
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312599704"
     variation       3594
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746955755"
     variation       3596
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754412601"
     variation       3605
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141497494"
     variation       3614
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272846171"
     variation       3621
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776469162"
     variation       3624
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761647543"
     variation       3625
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253404596"
     variation       3629
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150485708"
     variation       3640
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770700422"
     variation       3641
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146068581"
     variation       3649
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759091467"
     variation       3650
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2235941"
     variation       3653
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278786672"
     variation       3654
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761032911"
     variation       3658
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201987768"
     variation       3659
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754152010"
     variation       3661
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757559165"
     variation       3662
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369271634"
     variation       3665
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244757253"
     variation       3666
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477193621"
     variation       3668
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780059343"
     variation       3669
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748129270"
     variation       3672
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471014720"
     variation       3673
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769549273"
     variation       3675
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388565873"
     variation       3678
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574725058"
     variation       3680
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997812260"
     variation       3682
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323050349"
     variation       3683
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457498531"
     variation       3686
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777689742"
     variation       3689
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435375551"
     variation       3690
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749019468"
     variation       3692
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770753692"
     variation       3694
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774112678"
     variation       3699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112916671"
     variation       3700
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771724615"
     variation       3701
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1330066293"
     variation       3703
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774799825"
     variation       3704
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287521720"
     variation       3705
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569346985"
     variation       3706
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764498452"
     variation       3707
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045453"
     variation       3710
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762136052"
     variation       3712
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765546818"
     variation       3717
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372814690"
     variation       3718
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374166275"
     variation       3719
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484999693"
     variation       3722
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766483890"
     variation       3723
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751585348"
     variation       3728
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756132230"
     variation       3729
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142593689"
     variation       3732
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367070293"
     variation       3736
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472676297"
     variation       3737
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377688027"
     variation       3740
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778797101"
     variation       3741
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745525300"
     variation       3743
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149742017"
     variation       3744
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775126388"
     variation       3746..3754
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ctgcc"
                     /replace="ctgcctgcc"
                     /db_xref="dbSNP:755633779"
     variation       3750
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467423160"
     variation       3752
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371240081"
     variation       3754
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769247849"
     variation       3755
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375648175"
     variation       3758
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574725437"
     variation       3762
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490921022"
     variation       3764
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1033158609"
     variation       3767
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777035926"
     variation       3769
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762260649"
     variation       3771
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147548296"
     variation       3772
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773499522"
     variation       3774
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:80083765"
     variation       3776
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763226511"
     variation       3777
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766495555"
     variation       3783
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351184278"
     variation       3789
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751705783"
     variation       3791
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390977360"
     variation       3797
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427473381"
     variation       3798
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306986236"
     variation       3801
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141094521"
     variation       3812
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367662634"
     variation       3818
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951023136"
     variation       3820
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452775170"
     variation       3823
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528853967"
     variation       3824
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771222978"
     variation       3825
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199673601"
     variation       3826
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146958148"
     variation       3828
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767502282"
     variation       3829
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752824188"
     variation       3830
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368448658"
     variation       3831
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750284972"
     variation       3837
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149056994"
     variation       3839
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79013663"
     variation       3840
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751186186"
     variation       3843
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574731359"
     variation       3845
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456525980"
     variation       3846
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429991369"
     variation       3849
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196278445"
     variation       3850
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376615096"
     variation       3851
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372182010"
     variation       3852
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cacgcccgacttctggc"
                     /db_xref="dbSNP:1553129982"
     variation       3853
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376805421"
     variation       3854
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770333090"
     variation       3855
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551155934"
     variation       3857
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11556358"
     variation       3858
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749753031"
     variation       3861
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957664758"
     variation       3868
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368921599"
     variation       3869
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138823810"
     variation       3872
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761368413"
     variation       3873
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772329115"
     variation       3879
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265010777"
     variation       3882
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775763634"
     variation       3883
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760809964"
     variation       3886
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433842917"
     variation       3889
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269215290"
     variation       3892
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764231520"
     variation       3893
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373120664"
     variation       3894
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762890533"
     variation       3898
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433354261"
     variation       3899
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116659236"
     variation       3900
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754644904"
     variation       3903
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574731654"
     variation       3907
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780799624"
     variation       3912
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574731658"
     variation       3914
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375146224"
     variation       3915
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200774122"
     variation       3917
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777211267"
     variation       3935
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1292669844"
     variation       3936
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749768504"
     variation       3937
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771468469"
     variation       3939
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779207570"
     variation       3943
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746224045"
     variation       3947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772465677"
     variation       3948
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202051512"
     variation       3949
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549938102"
     variation       3954
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302750834"
     variation       3956
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384138843"
     variation       3957
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490905370"
     variation       3959
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377637892"
     variation       3960
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1295789247"
     variation       3964
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756826432"
     variation       3968
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214795071"
     variation       3972
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274553514"
     variation       3978
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309912546"
     variation       3981
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764604605"
     variation       3982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263712549"
     variation       3983
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566780533"
     variation       3984
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758911048"
     variation       3985
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373365649"
     variation       3986
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747364020"
     variation       3992
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187296625"
     variation       3993
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755298442"
     variation       3999
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781444810"
     variation       4002
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748277430"
     variation       4017
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769935693"
     variation       4021
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777652634"
     variation       4022
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1319044877"
     variation       4026
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1574737046"
     variation       4028
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:756835489"
     variation       4032
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745808043"
     variation       4042
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771988932"
     variation       4044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775316245"
     variation       4050
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218134256"
     variation       4051
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760433196"
     variation       4052
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768299819"
     variation       4055
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776371235"
     variation       4059
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267302438"
     variation       4060
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447339415"
     variation       4062
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761314990"
     variation       4063
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006876178"
     variation       4064
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326955726"
     variation       4067
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948723147"
     variation       4069
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764809017"
     variation       4070
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200174460"
     variation       4072..4077
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="tctc"
                     /replace="tctctc"
                     /db_xref="dbSNP:778684439"
     variation       4073
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766969618"
     variation       4077
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752010143"
     variation       4078
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755425089"
     variation       4079
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157561571"
     variation       4083
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376456276"
     variation       4091
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760058090"
     variation       4092
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371005244"
     variation       4093
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574737653"
     variation       4095
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:554386706"
     variation       4099
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752996515"
     variation       4101
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756414232"
     variation       4102
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574737684"
     variation       4103
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764194126"
     variation       4104
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996914255"
     variation       4105
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445914795"
     variation       4109
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249892765"
     variation       4117
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754022401"
     variation       4118
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184560323"
     variation       4122
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757354588"
     variation       4123
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778910187"
     variation       4124
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113481027"
     variation       4126
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76884346"
     variation       4127
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164560327"
     variation       4131
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746953833"
     variation       4136
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754867638"
     variation       4137
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166884290"
     variation       4138
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781101694"
     variation       4139
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393118851"
     variation       4142
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747874338"
     variation       4156
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769525596"
     variation       4160
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993800669"
     variation       4164
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772809991"
     variation       4165
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760382382"
     variation       4167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345534082"
     variation       4170
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773027767"
     variation       4171
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574737935"
     variation       4182
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182821450"
     variation       4188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316823043"
     variation       4191
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748901025"
     variation       4193
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226453964"
     variation       4196
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026005333"
     variation       4200
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253813299"
     variation       4201..4206
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="ccgaga"
                     /db_xref="dbSNP:1574737998"
     variation       4202
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144077160"
     variation       4203
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340126934"
     variation       4205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408295946"
     variation       4207
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200264736"
     variation       4208
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574738055"
     variation       4212
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574738067"
     variation       4213
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1574738072"
     variation       4218
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760151569"
     variation       4219
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374427295"
     variation       4221
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574738104"
     variation       4222
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557493387"
     variation       4223
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184603583"
     variation       4224
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775969085"
     variation       4226
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201795899"
     variation       4229
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:758227404"
     variation       4234
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414122586"
     variation       4235
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754077567"
     variation       4236
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463100080"
     variation       4237
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170225677"
     variation       4240
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771572984"
     variation       4241
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144540053"
     variation       4243
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761189855"
     variation       4245
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557495010"
     variation       4246
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414804617"
     variation       4252
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764451710"
     variation       4256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776976048"
     variation       4257
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159108440"
     variation       4259
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226458121"
     variation       4260
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574741088"
     variation       4262
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765424070"
     variation       4263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574741102"
     variation       4268
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750558328"
     variation       4269
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207667534"
     variation       4274
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139467328"
     variation       4275
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142593881"
     variation       4276
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374095972"
     variation       4277
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282256829"
     variation       4278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574741174"
     variation       4280
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409664993"
     variation       4284
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756048969"
     variation       4285
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159633959"
     variation       4290
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540351799"
     variation       4292
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867854392"
     variation       4295
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753668885"
     variation       4297
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757016780"
     variation       4298
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937555778"
     variation       4299
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778674703"
     variation       4306
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772282497"
     variation       4307
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1304974032"
     variation       4317
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771500483"
     variation       4329
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779554853"
     variation       4337
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747537252"
     variation       4345
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319082969"
     variation       4346
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244174340"
     variation       4351
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327084796"
     variation       4353
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202317107"
     variation       4358
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769139036"
     variation       4365
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359624079"
     variation       4367
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224084303"
     variation       4370
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777031172"
     variation       4372
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762136160"
     variation       4381
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75418232"
     variation       4386
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770155445"
     variation       4394
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557495743"
     variation       4395
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773558468"
     variation       4397
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371250281"
     variation       4400
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774340661"
     variation       4407
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1028761673"
     variation       4409
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762342695"
     variation       4417
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199511118"
     variation       4418..4421
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1574742231"
     variation       4419
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539301719"
     variation       4421
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297081817"
     variation       4422
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321414984"
     variation       4423
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574742272"
     variation       4425
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202925672"
     variation       4427
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954811404"
     variation       4428
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767662583"
     variation       4432
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462502244"
     variation       4437
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776725310"
     variation       4440
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761779302"
     variation       4442
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485630463"
     variation       4445
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765013340"
     variation       4448..4449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:773491131"
     variation       4449
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479763844"
     variation       4450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366153716"
     variation       4451..4454
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="gggg"
                     /db_xref="dbSNP:763165419"
     variation       4451
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987392907"
     variation       4453
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750219967"
     variation       4454
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574742382"
     variation       4460
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259235320"
     variation       4463
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425328387"
     variation       4465
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758036769"
     variation       4468
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766025298"
     variation       4470
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754504692"
     variation       4472
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431008363"
     variation       4478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290160409"
     variation       4480
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780621948"
     variation       4482
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459776659"
     variation       4483
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748657115"
     variation       4484
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283883161"
     variation       4485
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325513421"
     variation       4487
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756639334"
     variation       4494
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967069984"
     variation       4498
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978386792"
     variation       4506
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898374958"
     variation       4507
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372732208"
     variation       4512
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461313864"
     variation       4514
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765826238"
     variation       4526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11556356"
     variation       4527
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312511413"
     variation       4529
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937049224"
     variation       4532
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025397574"
     variation       4534
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055323176"
     variation       4535
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916739192"
     variation       4545
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269332074"
     variation       4557
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329155385"
     variation       4558
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1258565450"
     variation       4561
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429777952"
     variation       4564
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574742619"
     variation       4575
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377546463"
     variation       4578
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574742629"
     variation       4583
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549940917"
     variation       4588
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574742652"
     variation       4590
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:68078224"
     variation       4593
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201648724"
     variation       4600
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886651105"
     variation       4606
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178374999"
     variation       4607
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412704253"
     variation       4616
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:958601598"
     variation       4621
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157076880"
     variation       4622
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199996539"
     variation       4623
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914822604"
     variation       4625
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574742726"
     variation       4628
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574742731"
     variation       4629
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469281549"
     variation       4653
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12061168"
     variation       4655
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946229414"
     variation       4659
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412069843"
     variation       4660
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289518712"
     variation       4666
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350475818"
     variation       4670
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037638340"
     variation       4674
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304185298"
     variation       4687
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923392702"
     variation       4696
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363910809"
     variation       4698
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:899275247"
     variation       4699
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294890420"
     variation       4705
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:996198929"
     variation       4710
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:889148032"
     variation       4716
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028812489"
     variation       4723
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942024986"
     variation       4739
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767040661"
     variation       4740
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427292678"
     variation       4747
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433852919"
     variation       4750
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954562458"
     variation       4751
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038285708"
     variation       4753
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752326956"
     variation       4756
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994005618"
     variation       4757
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370370277"
     variation       4763
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025451310"
     variation       4772
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020204448"
     variation       4775
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967667904"
     variation       4777
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295817845"
     variation       4786
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907000620"
     variation       4788
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557496373"
     variation       4792
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369013567"
     variation       4793
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219377070"
     variation       4802
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978440778"
     variation       4814
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034494169"
     variation       4832
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486450545"
     variation       4851
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:925589263"
     variation       4853
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481691635"
     variation       4857
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958435690"
     variation       4859
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011238157"
     variation       4860
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021263816"
     variation       4871
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248384451"
     variation       4879
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488845861"
     variation       4880
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967623961"
     variation       4881
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977643084"
     variation       4887
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:958470597"
     variation       4910
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476674243"
     variation       4913
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169492704"
     variation       4920
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201120198"
     variation       4921
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1429485122"
     variation       4923
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868475728"
     variation       4929
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190714523"
     variation       4938
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1062921"
     variation       4947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986273342"
     variation       4947
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gg"
                     /replace="t"
                     /db_xref="dbSNP:370023317"
     variation       4948
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796112441"
     variation       4959
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167523719"
     variation       4966
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351037930"
     variation       4975
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1346921273"
     variation       4978
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574499069"
     variation       4979
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454231472"
     variation       4982
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324683057"
     variation       4988
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:910619512"
     variation       4990
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046965207"
     variation       4992
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368191092"
     variation       4995
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770651109"
     variation       4998..5005
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cctcc"
                     /replace="cctcctcc"
                     /db_xref="dbSNP:1297892966"
     variation       5002
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777426960"
     variation       5004
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142215987"
     variation       5005
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291919864"
     variation       5012
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322306595"
     variation       5014
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406783095"
     variation       5024
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271298790"
     variation       5032
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757017207"
     variation       5033
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778928121"
     variation       5038
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41266215"
     variation       5039
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241813143"
     variation       5041
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474626127"
     variation       5043
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184015646"
     variation       5044
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919235925"
     variation       5048
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461344941"
     variation       5054
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1163426261"
     variation       5056
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929907121"
     variation       5058..5089
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gcttccctga"
                     /replace="gcttccctgatatgtgctctgagcttccctga"
                     /db_xref="dbSNP:1458360594"
     variation       5063
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899159258"
     variation       5069
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1046951042"
     variation       5070
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576915288"
     variation       5078
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428358289"
     variation       5083
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050532814"
     variation       5088
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:890498243"
     variation       5090
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232544771"
     variation       5099
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008742365"
     variation       5108
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020509916"
     variation       5114
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903123408"
     variation       5116
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209504642"
     variation       5117
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055581451"
     variation       5118
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283805334"
     variation       5119
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445540329"
     variation       5120
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212554361"
     variation       5122..5127
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:1223989456"
     variation       5129
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475091690"
     variation       5134
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1000098528"
     variation       5135
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772227458"
     variation       5136
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473279114"
     variation       5145..5146
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1557496863"
     variation       5145
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775759549"
     variation       5155
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398551096"
     variation       5161
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335796883"
     variation       5165
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359459867"
     variation       5167
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414011001"
     variation       5170
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011289019"
     variation       5171
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75083199"
     variation       5172..5177
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="cccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:967024602"
     variation       5172
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747165315"
     variation       5173
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574743598"
     variation       5176
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1024065579"
     variation       5182
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1030999756"
     variation       5188
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574743622"
     variation       5195
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868252960"
     variation       5196
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1574743633"
     variation       5205
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1158304499"
     variation       5207
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563075964"
     variation       5209
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254565209"
     variation       5254
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426655684"
     variation       5255
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1181755774"
     variation       5256
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574743683"
     variation       5257
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362660469"
     variation       5259
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910683742"
     variation       5263
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173965464"
     variation       5264
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768987858"
     variation       5266
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403301813"
     variation       5273
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528519325"
     variation       5278
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879414076"
     variation       5279
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372216886"
     variation       5282
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776841837"
     variation       5292
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1374494364"
     variation       5297
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333982463"
     variation       5298
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554162928"
     variation       5303
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920637726"
     variation       5305
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542525016"
     variation       5310
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050825798"
     variation       5313
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890560049"
     variation       5319
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277161635"
     variation       5320
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343343738"
     variation       5322
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944766817"
     variation       5324
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1249121065"
     variation       5330
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041578924"
     variation       5333
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200434802"
     variation       5334
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903010107"
     variation       5335
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000151230"
     variation       5337
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253209549"
     variation       5338
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938575881"
     variation       5341
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291847701"
     variation       5350
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391727137"
     variation       5356
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1574743907"
     variation       5359
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462306317"
     variation       5360..5370
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="gt"
                     /replace="gtaggaccagt"
                     /db_xref="dbSNP:1358340585"
     variation       5360
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1557497191"
     variation       5361
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167254764"
     variation       5366
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218905849"
     variation       5371
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388567127"
     variation       5377
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1056035512"
     variation       5383
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553131366"
     variation       5385
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1032930542"
     variation       5386..5390
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1438914970"
     variation       5387
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300110552"
     variation       5403
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011362777"
     variation       5406
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557497281"
     variation       5413
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:562329398"
     variation       5415
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042811529"
     variation       5417
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998515601"
     variation       5426
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029964422"
     variation       5430
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273220275"
     variation       5431
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890706767"
     variation       5436
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176367915"
     variation       5439
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894360935"
     variation       5441
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770090283"
     variation       5443
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428880299"
     variation       5444
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371233220"
     variation       5447
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018203061"
     variation       5450
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963500786"
     variation       5451
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527287691"
     variation       5453
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460004837"
     variation       5457
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322793911"
     variation       5459
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527654687"
     variation       5461
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971194445"
     variation       5462
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293838060"
     variation       5467
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342663612"
     variation       5468
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973482272"
     variation       5470..5472
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1026352543"
     variation       5472
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1403872172"
     variation       5473
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172825658"
     variation       5478
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211338495"
     variation       5482
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:568275366"
     variation       5487
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441977712"
     variation       5492
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:950752352"
     variation       5493
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1574744218"
     variation       5496
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015127609"
     variation       5499
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425347295"
     variation       5502
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1574744236"
     variation       5503
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962183275"
     variation       5511
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982527186"
     variation       5514
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181469292"
     variation       5526
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296765675"
     variation       5542
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533033271"
     variation       5543
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146531759"
     variation       5544
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161515242"
     variation       5546
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569855586"
     variation       5549
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453268722"
     variation       5554
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287352527"
     variation       5558
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920854652"
     variation       5559
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:932209635"
     variation       5560
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312788466"
     variation       5564
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986170020"
     variation       5567
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911865637"
     variation       5575
                     /gene="PTPRU"
                     /gene_synonym="FMI; hPTP-J; PCP-2; PTP; PTP-J; PTP-PI;
                     PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944841859"
ORIGIN      
ccgctccgctccggctcgggctccggctcgcctcgggctgggctcgggctccgggggcggcgtcccccgcgccgggccccgggacgggcggcgacgctccaaccatggcccgtgcccaggcgctcgtgctggcactcaccttccagctctgcgcgccggagaccgagactccggcagctggctgcaccttcgaggaggcaagtgacccagcagtgccctgcgagtacagccaggcccagtacgatgacttccagtgggagcaagtgcgaatccaccctggcacccgggcacctgcggacctgccccacggctcctacttgatggtcaacacttcccagcatgccccaggccagcgagcccatgtcatcttccagagcctgagcgagaatgatacccactgtgtgcagttcagctacttcctgtacagccgggacgggcacagcccgggcaccctgggcgtctacgtgcgcgttaatgggggccccctgggcagtgctgtgtggaatatgactggatcccacggccgtcagtggcaccaggctgagctggctgtcagcactttctggcccaatgaatatcaggtgctgtttgaggccctcatctccccagaccgcaggggctacatgggcctagatgacatcctgcttctcagctacccctgcgcaaaggccccacacttctcccgcctgggcgacgtggaggtcaacgcgggccagaacgcgtcgttccagtgcatggccgcgggcagagcggccgaggccgaacgcttcctcttgcaacggcagagcggggcgctggtgccggcggcgggcgtgcggcacatcagccaccggcgcttcctggccactttcccgctggctgccgtgagccgcgccgagcaggacctgtaccgctgtgtgtcccaggccccgcgcggcgcgggcgtctctaacttcgcggagctcatcgtcaaggagcccccaactcccatcgcgcccccacagctgctgcgtgctggccccacctacctcatcatccagctcaacaccaactccatcattggcgacgggccgatcgtgcgcaaggagattgagtaccgcatggcgcgcgggccctgggctgaggtgcacgccgtcagcctgcagacctacaagctgtggcacctcgaccccgacacagagtatgagatcagcgtgctgctcacgcgtcccggagacggcggcactggccgccctgggccacccctcatcagccgcaccaaatgcgcagagcccatgagggcccccaaaggcctggcttttgctgagatccaggcccgtcagctgaccctgcagtgggaaccactgggctacaacgtgacgcgttgccacacctatactgtgtcgctgtgctatcactacaccctgggcagcagccacaaccagaccatccgagagtgtgtgaagacagagcaaggtgtcagccgctacaccatcaagaacctgctgccctatcggaacgttcacgtgaggcttgtcctcactaaccctgaggggcgcaaagagggcaaggaggtcactttccagacggatgaggatgtgcccagtgggattgcagccgagtccctgaccttcactccactggaggacatgatcttcctcaagtgggaggagccccaggagcccaatggtctcatcacccagtatgagatcagctaccagagcatcgagtcatcagacccggcagtgaacgtgccaggcccacgacgtaccatctccaagctccgcaatgagacctaccatgtcttctccaacctgcacccaggcaccacctacctgttctccgtgcgggcccgcacaggcaaaggcttcggccaggcggcactcactgagataaccactaacatctctgctcccagctttgattatgccgacatgccgtcacccctgggcgagtctgagaacaccatcaccgtgctgctgaggccggcacagggccgcggtgcgcccatcagtgtgtaccaggtgattgtggaggaggagcgggcgcggaggctgcggcgggagccaggtggacaggactgcttcccagtgccattgaccttcgaggcggcgctggcccgaggcctggtgcactacttcggggccgaactggcggccagcagtctacctgaggccatgccctttaccgtgggtgacaaccagacctaccgaggcttctggaacccaccacttgagcctaggaaggcctatctcatctacttccaggcagcaagccacctgaagggggagacccggctgaattgcatccgcattgccaggaaagctgcctgcaaggaaagcaagcggcccctggaggtgtcccagagatcggaggagatggggcttatcctgggcatctgtgcaggggggcttgctgtcctcatccttctcctgggtgccatcattgtcatcatccgcaaagggagagaccactatgcctactcctactacccgaagccggtgaacatgaccaaggccaccgtcaactaccgccaggagaagacacacatgatgagcgccgtggaccgcagcttcacagaccagagcaccctgcaggaggacgagcggctgggcctgtccttcatggacacccatggctacagcacccggggagaccagcgcagcggtggggtcactgaggccagcagcctcctggggggctccccgaggcgtccctgtggccggaagggctccccataccacacggggcagctgcaccctgcggtgcgtgtcgcagaccttctgcagcacatcaaccagatgaagacggccgagggttacggcttcaagcaggagtatgagagcttctttgaaggctgggacgccacaaagaagaaagacaaggtcaagggcagccggcaggagccaatgcctgcctatgatcggcaccgagtgaaactgcacccgatgctgggagaccccaatgccgactacattaatgccaactacatagatggttaccacaggtcaaaccacttcatagccactcaagggccgaagcctgagatggtctatgacttctggcgtatggtgtggcaggagcactgttccagcatcgtcatgatcaccaagctggtcgaggtgaaatgctcacggtactggccggaggactcagacacctacggggacatcaagattatgctggtgaagacagagaccctggctgagtatgtcgtgcgcacttttgccctggagcggagaggctactctgcccggcacgaggtccgccagttccacttcacagcgtggccagagcatggcgtcccctaccatgccacggggctgctggctttcatccggcgcgtgaaggcctccaccccacctgatgccgggcccattgtcatccactgcagcgcgggcaccggccgcacaggttgctatatcgtcctggatgtgatgctggacatggcagagtgtgagggcgtcgtggacatttacaactgtgtgaagactctctgctcccggcgtgtcaacatgatccagactgaggagcagtacatcttcattcatgatgcaatcctggaggcctgcctgtgtggggagaccaccatccctgtcagtgagttcaaggccacctacaaggagatgatccgcattgatcctcagagtaattcctcccagctgcgggaagagttccagacgctgaactcggtcaccccgccgctggacgtggaggagtgcagcatcgccctgttgccccggaaccgcgacaagaaccgcagcatggacgtcctgccgcccgaccgctgcctgcccttcctcatctccactgatggggactccaacaactacattaatgcagccctgactgacagctacacacggagtgcggccttcatcgtgaccctgcacccgctgcagagcaccacgcccgacttctggcggctggtctacgattacgggtgcacctccatcgtcatgctcaaccagctgaaccagtccaactccgcctggccctgcctgcagtactggccagagccaggccggcagcaatatggcctcatggaggtggagtttatgtcgggcacagctgatgaagacttagtggctcgagtcttccgggtgcagaacatctctcggttgcaggaggggcacctgctggtgcggcacttccagttcctgcgctggtctgcataccgggacacacctgactccaagaaggccttcttgcacctgctggctgaggtggacaagtggcaggccgagagtggggatgggcgcaccatcgtgcactgcctaaacgggggaggacgcagcggcaccttctgcgcctgcgccacggtcctggagatgatccgctgccacaacttggtggacgttttctttgctgccaaaaccctccggaactacaaacccaacatggtggagaccatggatcagtaccacttttgctacgatgtggccctggagtacttggaggggctggagtcaagatagcggggccctggcctggggcacccactgcacactcagggccagacccaccatcctggactggcgaggaagatcagtgcctcctgctctgcccaaacacactcccatggggcaagcactggagtggatgctgggctatcttgctcccccttccactgtgggcagggcctttcgcttgtcccatgggcgggtggtgggccaaggaggagcttagcaagtctgcagcccagccccacctccatagggtcctgcaggcctgtgctgagaggcctggtgctgcctggcagagtgacaaaggctcaggacggctggctctgggggactcaggccaagccccttggcaccatcctggcttttggcagggatgagtgaggccctgcagagagcatcccaggccaaggttcccactcagcctgccccctctgcatgtgggtagaggatgtactgggacttggcatttaggattccatctggcccagcccctgaaggtcctggggaagcaggtctcaattctgaatagccagtggggcacactgactgtcctccccaggggaactgcagcgccctcctccccactgccccctgcagcccctgagatattttgctcactatccctccccacttgcttccctgatatgtgctctgagcttccctgaaccaggatctgcctattactgctgtgccccatggggggctccttccctgcctgacccactgttgcagaatgaagtcacctcgcccccctcttcctttaatcttcaggcctcactggcctgtcctgctcagcttgggccagtgacaatctgcaaggctgaacaacagcccctggggttgaggcccctgtggctcctggtcaggctgcccgttgtggggaggggcagtgttagagcagggctggtcataccctctggagttcagaggaagaggtaggaccagtgcttttttgtttcttttgttatttttggttgggtgggtgggaaggtctctttaaaatggggcaggccacacccccattccgtgcctcaatttccccatctgtaaactgtagatatgactactgacctacctcgcagggggctgtggggaggcataagctgatgtttgtaaagcgctttgtaaataaacgtgctctctgaatgccaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]