2025-07-06 11:37:05, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_016974869 3144 bp mRNA linear ROD 10-JUL-2020 DEFINITION PREDICTED: Cricetulus griseus protein argonaute-3 (LOC100769090), transcript variant X3, mRNA. ACCESSION XM_016974869 VERSION XM_016974869.3 DBLINK BioProject: PRJNA72741 KEYWORDS RefSeq. SOURCE Cricetulus griseus (Chinese hamster) ORGANISM Cricetulus griseus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Cricetidae; Cricetinae; Cricetulus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_003613817.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jul 10, 2020 this sequence version replaced XM_016974869.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cricetulus griseus Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3144 /organism="Cricetulus griseus" /mol_type="mRNA" /db_xref="taxon:10029" /chromosome="Unknown" /cell_line="CHO-K1" gene 1..3144 /gene="LOC100769090" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 66 samples with support for all annotated introns" /db_xref="GeneID:100769090" CDS 185..2065 /gene="LOC100769090" /codon_start=1 /product="protein argonaute-3 isoform X2" /protein_id="XP_016830358.1" /db_xref="GeneID:100769090" /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYALQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 185..526 /gene="LOC100769090" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(320..322,365..367,407..409,419..421,473..475, 494..496,500..502) /gene="LOC100769090" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 659..1936 /gene="LOC100769090" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1070..1072,1082..1084,1118..1129,1136..1138, 1160..1162,1169..1171,1181..1183,1193..1195) /gene="LOC100769090" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1274..1276,1280..1282,1490..1492,1904..1906) /gene="LOC100769090" /note="active site" /db_xref="CDD:240015" ORIGIN
agaggagaaaaaggtaatctgagaagccagtagggggcttttcaatcatagttcaggtttcaatctacacgttacttccttaagaagcagtgtttgacacccttctcccccagtccagccatcccccaagtctgagttagtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataacattgatgagcaacccagacctctgactgattctcatcgggtaaaattcactaaggagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagccatcaaacctttcctttacagttagaaaatggccagactgtggagagaactgtagcccagtatttcagagaaaagtacgctcttcagctgaagtaccctcaccttccctgtctgcaagtggggcaggagcagaagcatacgtacctgccgctagaagtctgcaatattgtggctgggcaacggtgtatcaagaaactaacagacaatcagacttctaccatgattaaggcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaactatgaaacagatccattcgttcaggagtttcaatttaaagtgcgggatgaaatggctcatgtaaccggacgtgtccttccagcacctatgctccagtatggaggacggaaccggacagtggcaacaccgagccacggtgtgtgggacatgcgaggaaaacaattccacacaggagttgaaatcaaaatgtgggccatagcctgttttgccacacagaggcagtgcagagaggaaatactgaaaggtttcacggaccagcttcgaaagatttccaaggatgcagggatgcctatccaaggccagccatgcttctgcaaatatgcacagggagcagacagtgtggagcccatgttccgacatcttaagaatacatattcaggactgcagctcattatcgtcatcctgccaggaaagacacctgtgtatgcggaggtgaagcgtgtaggagatacacttttgggtatggccacacagtgtgtgcaagtcaagaatgtaataaaaacatctcctcaaactctatcaaatttgtgcctaaagatcaatgttaaacttggaggaatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatcttcctgggcgcagatgtcactcacccacctgctggtgatgggaagaagccctccattgctgctgttgtaggtagtatggatgcccatccaagcagatactgtgccacagtaagagttcagagaccccggcaggaaatcatccaggacttggcctccatggtccgggaactgctcatccaattttataagtcaacccgattcaaacctactcgcattatcttttatcgggatggtgtttcagaaggacaatttagacaggtattatactacgagctactggcaattcgagaagcctgtatcagtttggaaaaagactatcaacctggaataacctacattgtagttcagaagagacatcatacacgattgttttgtgctgacagaacagaaagggttgggagaagtggcaacatcccagctggtaccacagttgacaccgacattactcacccgtatgagtttgacttctatctctgtagccatgctggaatacagggaaccagccgtccttcacactatcacgtcttgtgggatgacaactgtttcactgcagatgaacttcagctgctgacttaccagctctgtcacacctacgtgaggtgcacacgctctgtctccattcctgcccctgcatattatgcccacctggtggcattcagagccagatatcaccttgtggacaaggaacatgacagtgctgaaggcagccacgtttcaggacagagcaatgggcgagatccacaggctcttgcaaaggctgtacaaatccaccaagataccttacgcacaatgtacttcgcttaacaagtccacatgcattctttgggaggaagagctgaaaggcagatcaacaacagtgtgtgtttgcagtggagtcagctcactggggatgctccggccatcccgaagccaacactgtaagggttggtcctgttgatccatggaaaattgtttactttgtcaaggaacaaagtaccattgtgcactcgggaaccagccagctgcttttttgcagtctcccgtaggaagcattgcagttgtttattttcacttcttacagtctaacccttttaatgcctttacctcaagttgcttggcagcacaaatacctttgcaaaaaagaaaaagtgaatgatggtttaaaaacacacacctacatgaataatgattgttcagttacatgtgcagaaaacaatgtgcactcctctgtttttataaaggggtgtgtatttaaatacacacaggtatacttcacgtgcatatatgtctccatctagactaacgatatgcatgtgtctgtgtgtatattttatagttcattccactggggaactttcttttcctggcatccctctttgtgccaccgtcatttcccccctacttgcattcagcgtctacacttctgtccctagtgctacaatcgacagtcatgcgttcatatatatgattcatttgaagtaaagcatggcaaactaggtttctgtttttattttatgtaccctactcctagctcctatctcatacacatagttctgggtccttgctcctaaggccatgtttgcgagtgtctgctccttcttgctctggatttccctttgccatgtgtgctctgtctatagaaacagtggcaacccaagtattcctctctgtagtgcgtgtgctaaagctgctataagtacaaaaccttgtcagaagtccttcagatcagtgacaaatattctgaagcctctgtatgagttatacctgaaaatcccttaaagcttttataaagggtaaatatttttaaaaatctgaaactctataagtagggaaagaaaaggaattaggggttcttggtgtttgctagtttactgactaccctcataccttaatgtgaaacatat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]