2025-07-16 04:31:15, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_016974868 2541 bp mRNA linear ROD 10-JUL-2020 DEFINITION PREDICTED: Cricetulus griseus protein argonaute-1 (LOC100768807), transcript variant X2, mRNA. ACCESSION XM_016974868 VERSION XM_016974868.3 DBLINK BioProject: PRJNA72741 KEYWORDS RefSeq. SOURCE Cricetulus griseus (Chinese hamster) ORGANISM Cricetulus griseus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Cricetidae; Cricetinae; Cricetulus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_003613817.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jul 10, 2020 this sequence version replaced XM_016974868.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cricetulus griseus Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2541 /organism="Cricetulus griseus" /mol_type="mRNA" /db_xref="taxon:10029" /chromosome="Unknown" /cell_line="CHO-K1" gene 1..2541 /gene="LOC100768807" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 30 Proteins" /db_xref="GeneID:100768807" CDS 193..2541 /gene="LOC100768807" /codon_start=1 /product="protein argonaute-1 isoform X2" /protein_id="XP_016830357.1" /db_xref="GeneID:100768807" /translation="
MVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
misc_feature 235..459 /gene="LOC100768807" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 487..639 /gene="LOC100768807" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 640..1002 /gene="LOC100768807" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(796..798,841..843,883..885,895..897,949..951, 970..972,976..978) /gene="LOC100768807" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1135..2412 /gene="LOC100768807" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1546..1548,1558..1560,1594..1605,1612..1614, 1636..1638,1645..1647,1657..1659,1669..1671) /gene="LOC100768807" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1750..1752,1756..1758,1966..1968,2380..2382) /gene="LOC100768807" /note="active site" /db_xref="CDD:240015" ORIGIN
gcctacctgcctcccctgcagcaggtgttccaggcacctcgacggcctggcattggcactgtgggcaaaccaatcaagcttctggccaattactttgaggtggacattcctaagattgatgtttatcattacgaggtggacatcaagccggataagtgtcctcgaagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatcttcggggatcgcaagcccgtctatgatggaaagaagaacatttacactgtcactgcactgcccattggcaacgagagggttgactttgaggtgacaatccctggggaagggaaagatagaatttttaaggtctccatcaagtggctagccattgtgagctggcgtatgctacatgaagccctggtcagtggccagatccctgtgcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcgtctatgaggtacacccctgtgggccgttccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtatcagccactgccttctacaaagcacagccagtgattgagttcatgtgtgaggtcctggacatcaggaacatagatgaacagcccaagcccctcacagattcccagcgtgttcgctttaccaaggagataaaaggcctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgcgtgtgtaatgttacccgacgccctgctagtcatcagacgtttcccttgcagctggagagtggacagactgtggaatgtactgtggcacagtatttcaagcagaaatacaaccttcaactcaagtatcctcacctgccctgcctacaagttgggcaagagcaaaagcatacctatttgcccctggaggtctgtaacattgtggccgggcagcggtgcattaagaagttgactgacaaccagacctcaaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttggaatcaaagtgaaggatgacatgacggaggtgacggggcgagtgctgccggcgcccatcttgcaatatggcggccggaatcgggccattgctacacccaaccaaggtgtctgggacatgcgtgggaaacaattctacaatggcattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacaatgtcgagaagaagtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcccatccagggtcagccttgtttctgcaaatatgcacagggagcagatagtgtggagcccatgttccggcatctaaagaacacctactcaggactgcagctcattatcgtcatcctgccagggaagacgcctgtgtatgctgaagtgaaacgtgttggagacacacttttgggaatggcaacacagtgtgtgcaggtgaagaatgtggtgaagacctcacctcagactctgtccaacctctgcctcaagatcaacgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgctgtttttcaacagccagtgattttcctgggcgcagatgttacacaccccccagccggggacgggaagaagccgtctatcacagcggtggtaggcagtatggacgcacaccccagccgatactgtgctactgtgcgtgtgcagcgcccacggcaggagatcattgaagacttgtcctatatggtgcgtgagctgctcatccagttctataagtccactcgcttcaagcccacccgcatcatcttctaccgagatggggtccctgagggccagctaccccagatccttcactatgagctgcttgccattcgagatgcctgcatcaaactggaaaaagactaccagcctgggatcacttacattgtggtgcagaaacgccatcatacccgccttttttgtgctgacaagaatgaacgaattgggaagagtggtaacatccccgctgggaccactgtggacaccaacatcactcacccatttgaatttgacttctatctgtgcagccatgcaggcatccagggtaccagccgaccatcccattattatgtcctttgggacgacaaccgtttcacagcagatgaactccagatcttgacataccagctgtgccacacttacgtacgatgtacacgttctgtctctatcccagcacctgcctactatgcccggttggtggctttccgggcacggtaccacctggtggacaaggagcatgacagtggagaggggagccacatatcagggcagagcaatggacgagacccccaggccctggccaaagctgtgcaggttcaccaggatacgctacgcaccatgtacttcgcttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]