LOCUS       XM_016832705             669 bp    mRNA    linear   PLN 25-APR-2021
DEFINITION  PREDICTED: Gossypium hirsutum uncharacterized LOC107905914
            (LOC107905914), mRNA.
ACCESSION   XM_016832705
VERSION     XM_016832705.2
DBLINK      BioProject: PRJNA713846
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Gossypium hirsutum (cotton)
  ORGANISM  Gossypium hirsutum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Malvales; Malvaceae; Malvoideae;
            Gossypium.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_053434.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 25, 2021 this sequence version replaced XM_016832705.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gossypium hirsutum Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..669
                     /organism="Gossypium hirsutum"
                     /mol_type="mRNA"
                     /isolate="1008001.06"
                     /db_xref="taxon:3635"
                     /chromosome="A11"
     gene            1..669
                     /gene="LOC107905914"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:107905914"
     CDS             1..669
                     /gene="LOC107905914"
                     /codon_start=1
                     /product="uncharacterized protein LOC107905914"
                     /protein_id="XP_016688194.2"
                     /db_xref="GeneID:107905914"
                     /translation="

MKKYNRLQSIAKVFRIFEVLSALLFLAWTAERVPFAIKISGEFVLKLGGIIASPFFVFLICNLIIITLIAKSGIFSALRNADSKVCEEIIIKTADTHSKSVSQEEIVYQDKEIISEVNTSTRECENMEPELEPESDSDFEADNRRVYRRSKSEKLEREKVKKELRRSESEKKCQKIENMDEKLFPEDDLSNEEFQRAIEDFIAKQLRFRREESLSIVLQSQA"

ORIGIN      

atgaagaaatacaatcgtcttcaaagcatagcaaaggtgtttcgtatttttgaagtgctttcggctttgctgtttttggcgtggactgccgagcgcgtgccttttgccatcaaaatctccggcgagtttgttttgaaactcggcggcatcatcgccagtccgttcttcgttttcctcatctgtaacctcatcatcatcactctaattgctaagtccggtatcttctccgcccttcgcaatgccgattccaaagtctgcgaggaaataatcatcaagaccgcagacactcactccaaatcggtgtctcaagaagagattgtgtatcaagataaggagatcatctctgaagtgaacacatctactcgcgagtgcgaaaacatggaaccagaactggagccagagtcagactctgactttgaagccgataatcggagagtgtataggagaagtaaatcggagaagttggaaagggagaaagtgaaaaaggaactacgacgatcggagagcgagaagaaatgccaaaaaattgaaaacatggacgaaaaattatttcctgaagacgatttgagcaatgaagagtttcaacgagcgatcgaagactttattgctaaacagttgaggtttcgccgagaagagtctctgtctattgttcttcaaagccaagcttga

//