ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-25 21:30:11, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_016832705 669 bp mRNA linear PLN 06-AUG-2024
DEFINITION PREDICTED: Gossypium hirsutum uncharacterized protein
(LOC107905914), mRNA.
ACCESSION XM_016832705
VERSION XM_016832705.2
DBLINK BioProject: PRJNA713846
KEYWORDS RefSeq; includes ab initio.
SOURCE Gossypium hirsutum (cotton)
ORGANISM Gossypium hirsutum
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; rosids; malvids; Malvales; Malvaceae; Malvoideae;
Gossypium.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_053434.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
On Apr 25, 2021 this sequence version replaced XM_016832705.1.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_007990345.1-RS_2024_08
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.3
Annotation Method :: Best-placed RefSeq; Gnomon;
cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 08/01/2024
##Genome-Annotation-Data-END##
##RefSeq-Attributes-START##
ab initio :: 100% of CDS bases
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..669
/organism="Gossypium hirsutum"
/mol_type="mRNA"
/isolate="1008001.06"
/db_xref="taxon:3635"
/chromosome="A11"
gene 1..669
/gene="LOC107905914"
/note="uncharacterized LOC107905914; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 1
Protein"
/db_xref="GeneID:107905914"
CDS 1..669
/gene="LOC107905914"
/codon_start=1
/product="uncharacterized protein"
/protein_id="XP_016688194.2"
/db_xref="GeneID:107905914"
/translation="
MKKYNRLQSIAKVFRIFEVLSALLFLAWTAERVPFAIKISGEFVLKLGGIIASPFFVFLICNLIIITLIAKSGIFSALRNADSKVCEEIIIKTADTHSKSVSQEEIVYQDKEIISEVNTSTRECENMEPELEPESDSDFEADNRRVYRRSKSEKLEREKVKKELRRSESEKKCQKIENMDEKLFPEDDLSNEEFQRAIEDFIAKQLRFRREESLSIVLQSQA"
ORIGIN
atgaagaaatacaatcgtcttcaaagcatagcaaaggtgtttcgtatttttgaagtgctttcggctttgctgtttttggcgtggactgccgagcgcgtgccttttgccatcaaaatctccggcgagtttgttttgaaactcggcggcatcatcgccagtccgttcttcgttttcctcatctgtaacctcatcatcatcactctaattgctaagtccggtatcttctccgcccttcgcaatgccgattccaaagtctgcgaggaaataatcatcaagaccgcagacactcactccaaatcggtgtctcaagaagagattgtgtatcaagataaggagatcatctctgaagtgaacacatctactcgcgagtgcgaaaacatggaaccagaactggagccagagtcagactctgactttgaagccgataatcggagagtgtataggagaagtaaatcggagaagttggaaagggagaaagtgaaaaaggaactacgacgatcggagagcgagaagaaatgccaaaaaattgaaaacatggacgaaaaattatttcctgaagacgatttgagcaatgaagagtttcaacgagcgatcgaagactttattgctaaacagttgaggtttcgccgagaagagtctctgtctattgttcttcaaagccaagcttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]