LOCUS       XM_016471800            1704 bp    mRNA    linear   VRT 03-MAY-2016
DEFINITION  PREDICTED: Sinocyclocheilus anshuiensis uncharacterized
            LOC107677019 (LOC107677019), mRNA.
ACCESSION   XM_016471800
VERSION     XM_016471800.1
DBLINK      BioProject: PRJNA319338
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Sinocyclocheilus anshuiensis
  ORGANISM  Sinocyclocheilus anshuiensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015557087.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Sinocyclocheilus anshuiensis
                                           Annotation Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 3% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1704
                     /organism="Sinocyclocheilus anshuiensis"
                     /mol_type="mRNA"
                     /isolate="Anshui"
                     /db_xref="taxon:1608454"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="China: Lingyun, Guangxi"
                     /collection_date="2012-08-20"
                     /note="cave-restricted"
     gene            1..1704
                     /gene="LOC107677019"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 84% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:107677019"
     CDS             1..1704
                     /gene="LOC107677019"
                     /codon_start=1
                     /product="uncharacterized protein LOC107677019"
                     /protein_id="XP_016327286.1"
                     /db_xref="GeneID:107677019"
                     /translation="

MMRSFQHSYFQLLYLLMAALLECKGKQRPCKQVHQLNISHLHGDSMSISCQSTTHPLDSLTVKLHSINPVKDILVYPDISPASEHQRWSVRKDDGNVTLDLKDIRLSDGGLYDCQVYKDQDCLHATQFYLSIIQCKTLNSVHATLNSQVLLPCSEHPLQNRTERVTWKVINGHQLTDITQYRAPNKPSSSTENQKELYFLSGCLISLFYSLLPETERPCKQVHQLNISHLHGDSMSISCQSTTHPLDSLTVKLHSINPVKDILVYPDISPASEHQRWSVRKDDGNVTLDLKDIRLSDGGLYDCQVYKDQDCLHATQFYLSIIQCKTLNSVHATLNSQVLLPCSEHPLQNRTERVTWKVINGHQLTDITQYRAPNKPSSSTEKPPNPLFERARQLKNGSLLIRKAVATDELWYHCRVNEKTCYEMRLVMKAHNTSRSTKVLETLSTTLVTTASADSLAGLAENNSDGSETVTTNLTVVVMVTTVVSLCVLISLTICVILYFKKQRRKTNSQTQLNSRFSVYYSRVAEGFDVPLYSLVEQNTGTMITFGAAQSEAPACKADNMYEKLTL"

     misc_feature    127..378
                     /gene="LOC107677019"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    136..150
                     /gene="LOC107677019"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    181..201
                     /gene="LOC107677019"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    289..303
                     /gene="LOC107677019"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    331..348
                     /gene="LOC107677019"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    694..945
                     /gene="LOC107677019"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    703..717
                     /gene="LOC107677019"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    748..768
                     /gene="LOC107677019"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    856..870
                     /gene="LOC107677019"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    898..915
                     /gene="LOC107677019"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
ORIGIN      

atgatgaggagttttcagcattcttatttccaactcctgtatcttctaatggcagcgttattagaatgcaaaggtaagcagagaccctgcaagcaggttcatcagttgaacataagccatttacatggtgacagcatgtctatttcttgccaatcaacaacccacccgctggattctctaacagtcaaactacacagtatcaacccggttaaagacattctggtgtatccagacatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaatgttacacttgatctgaaagacatcagattatccgatggtggtctttatgactgtcaggtctacaaggatcaggactgccttcatgcaacacaattttacctgagtattatacagtgtaaaactttgaactctgtccatgcaacgctaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaacgagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcagcacagagaatcagaaagagctttattttctctcaggatgtctcatttctcttttttattcccttttacccgaaacagagagaccctgcaagcaggttcatcagttgaacataagccatttacatggtgacagcatgtctatttcttgccaatcaacaacccacccgctggattctctaacagtcaaactacacagtatcaacccggttaaagacattctggtgtatccagacatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaatgttacacttgatctgaaagacatcagattatccgatggtggtctttatgactgtcaggtctacaaggatcaggactgccttcatgcaacacaattttacctgagtattatacagtgtaaaactttgaactctgtccatgcaacgctaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaacgagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcagcacagagaaacccccgaaccccctgtttgagagagcgagacaactaaagaacggatctttgcttataagaaaagcggtcgccactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagctcataatacatctcgttccacaaaggtattagaaacactttccacaacattggtaaccacagcctctgctgacagtcttgctggcctggctgaaaataacagtgatgggagtgaaacagtgacaactaatctgacagtagtagtgatggtgaccacagtagtgtctctgtgtgtcctcatatcactaaccatctgcgtcattctttatttcaaaaaacaaaggcgcaaaaccaacagccaaacacagttaaacagtcggttctctgtgtattactcccgtgttgcagaagggtttgatgtcccattgtattctttagttgaacaaaacacaggaacaatgatcacctttggtgctgcacaatcagaagctccggcatgtaaagcagataacatgtatgaaaagttaacattgtga

//