LOCUS       XM_016300582            6199 bp    mRNA    linear   VRT 20-APR-2016
DEFINITION  PREDICTED: Ficedula albicollis ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_016300582
VERSION     XM_016300582.1
DBLINK      BioProject: PRJNA208061
KEYWORDS    RefSeq.
SOURCE      Ficedula albicollis (Collared flycatcher)
  ORGANISM  Ficedula albicollis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Muscicapidae;
            Ficedula.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_021671.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Ficedula albicollis Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6199
                     /organism="Ficedula albicollis"
                     /mol_type="mRNA"
                     /isolate="OC2"
                     /db_xref="taxon:59894"
                     /chromosome="1"
                     /sex="male"
                     /country="Sweden: Oland"
                     /collection_date="2009"
     gene            1..6199
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 Proteins, and 98% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:101818277"
     CDS             228..4802
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_016156068.1"
                     /db_xref="GeneID:101818277"
                     /translation="

MERKLDNKMKRELSYLATLNDRNISLVAIRKQQAACDVPELLIIGEKSKTASPVKARRSLQKEEKLLQSYSMGKTEVNTVERQALSNIDSPPDCELKPTMKHNFAFDNMGYEESSETVPSPPSQEHTVVVNIVGMTCQSCVQSIEGQISKVKGILRIKVSLEQNNAVIKYLQSEINPEQICQEILGMGFDASVAEEKSTAATVNLPSLKEAVVKLRVEGMTCQSCVTNIEGKIRKMHGVAKIKVSLDNQEAIIAYHPYIIQPDDLKRHISDMGYDCTIKSKSAPLKLGALDLQRLQNAKSRETPASLESDGLDLLVTELGSTATVTLQIEGMHCKSCVRNIEGNISDLPGIKSIEVSLEHKCAVVEYSPDLITLSALQQAIEALPPGNFKVSLLNGSEANKAPSGAFAYSITRQPPQGTAHTAVIKIGGMTCNSCAQSIEGAVSQRQGVQRVAVSLAGGTGTIHYDPAVTSAEELRAAIEDMGFDASVLTDTAAGEHRRQPDGSKAAVQPRAPEPPRQGDASDALPSSPHPDGSNQLSGATEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENDAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLDHKKEIQQWRKSFLFSLVFGIPVVVIMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYLYSCVILIVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVKEEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVIKKPGSTVIAGSINAHGSLLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAIPGCGISCKVGGVEAVLGTAEEGPNKQDANRSAALGDKAAITPLESQGPSASQKYSVLIGNREWMRRNGLNITNDVNDAMTNHEMKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLQSMGIDVVLLTGDNRKTAKAIATQVGIRKVFAEVLPSHKVAKVQELQSGKKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNMLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDPSKPSPWDQTSQVSLSSLASDKLPKRHGLLEEERGKWSSLINAADEEQYI"

     misc_feature    612..803
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(630..638,645..647)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    867..1058
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(885..893,900..902)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1203..1379
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1221..1229,1236..1238)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1497..1688
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1515..1523,1530..1532)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1863..2054
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1881..1889,1896..1898)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2091..2282
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2109..2117,2124..2126)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2346..4475
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3339..3341,3345..3347,4404..4406)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3471..3479,3681..3683,3855..3863,3951..3953,
                     4071..4079,4137..4139,4146..4148,4155..4157,4212..4214,
                     4221..4223)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gcagggagagcaggtagctgagtgcagcaagcagcctacaatacgtaaggatcacaggttccatctgggatttggtggtgaatgcctaataagcacatggattagccgggcagaactcttcaagctgttgtaaatgtagctgaaagaagcgtggcttgtgggacaacaaatagctgctctcgtaaaacttttgtttggcactgcaatatttaaagtccagaaaaataatggagagaaaactggacaataaaatgaaaagggagctgtcctacttagctactttaaacgacagaaacatatccctggtggctattcgtaagcagcaggcagcttgtgatgtgcctgaactactgattattggtgaaaagtccaagacagcatcgccggtaaaagcaagaaggagcttgcagaaagaagagaaacttttgcagagttactccatgggaaagacagaagtcaatacagttgaaagacaggctttgtccaacattgattctcctcctgattgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggagagctctgaaaccgtgccctctccaccttcccaagagcatactgtggtagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccagatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgccgttatcaagtatctgcagtcggaaataaaccctgaacaaatttgccaggaaattctgggtatgggctttgatgccagcgtagcagaagagaagtcgacagcagcgactgtaaatttgccgagcttgaaagaagcagtggttaagcttcgggtagaaggcatgacgtgccagtcctgtgtcaccaacattgaaggaaagattaggaaaatgcacggtgtagcaaaaatcaaggtgtcacttgataaccaagaagcaattattgcttaccatccttacatcattcagcctgatgacctcaagaggcacatcagtgacatggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcctgcagaatgcaaaatccagggagacacctgcaagtcttgagagtgatgggctggatctgttggtcaccgagttgggtagcacagcaacagtgactctacagatcgagggcatgcactgcaagtcctgtgtcagaaacatcgaagggaatatatcagatcttcctggcataaaaagtattgaagtgtctttggagcataagtgtgctgtggtagagtacagcccagatttaatcaccctgtcagctttgcagcaggctattgaagcccttccacctggaaactttaaagtgagcctccttaatggttcagaagcaaataaagcaccctcaggtgctttcgcctacagtatcaccagacagccaccgcaaggcacggcacacacagctgttattaagattggtggcatgacctgcaattcttgtgcacagtccatagaaggggccgtgtcacagagacaaggagtgcagcgtgtagcagtttccctagctggtggtactgggaccatacactatgatccagctgtcactagtgcagaagagttaagagctgccatagaagacatgggatttgatgcctctgtgctaacagataccgctgctggagaacacaggcgccagcctgatggcagcaaagctgctgtgcagcctcgagctccagagcctcctcgccaaggtgatgcctcagatgctcttcccagcagtcctcaccctgatgggtcaaaccagctcagtggagccacagaagagaagtgtgttttgcaaatcaccggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcggtgttggtagcgctgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaatgatgcagaaacagaagggcaagtggagcttcttattacggggatgacttgtgcttcttgtgttcacaacattgagtccaagctcatgagaacgaatggcatattctctgcctcagttgcgcttgcgactagcaaagctcacatccagttcgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcttgttcagcctagtgtttggtatccctgttgtagtcataatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtgctggaacagaacctcattcccggattatctattttgaatcttctattttttatcctgtgcacttttgttcagttccttggtggatggtatttttacgtacaagcttacaagtcactgaggcacaagacagccaatatggatgtgctcatcgttctggccacaacaattgcttacctgtattcctgtgtgatcctgatagtagcaatcattgaaaaggcagagaaaagccctgtcactttcttcgacactcctccgatgttgtttgtgttcatcgcgctcggcagatggctggaacacatagccaagggtaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccaccgtggtgactcttggacctggccactctattgtcaaggaggagcaagtgcctgttgaactggttcaaaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgacggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggatctataaatgcacatggctcacttcttgttaatgcaactcatgttggtaatgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataaatttagtggatattttgttccatttatcatcatcatttcaactgtgacattgatagtatggatcacaattggttttgtaaattttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcactggagtggctgcacagaatggtattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggcagttgtgggtacagcagaagccagcagtgagcatcctttaggaatggccgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcaccgacttccaggcaatcccaggctgtggtatcagctgcaaggttggaggagttgaggccgtccttggcacagctgaggaaggtcccaataagcaggatgctaacaggagtgctgctctgggagataaggcagcaatcacacccttggaatcacaaggtccatcagcttctcagaaatactcggtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattacaaatgatgtaaatgatgctatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgcagagcatgggaatagacgtggtgctcctgacaggggacaacaggaaaactgcaaaagccattgctactcaggttggcatcagaaaagtctttgcagaggttctcccttctcacaaggttgcaaaggtccaggaactccaaagtggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccagggccgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgttcttatccgaaatgatttgctggatgtagttgccagtattcacttatccaagagaaccgttcgaagaatacgaataaatctgatccttgccctaatttataatatgcttggaatacccatagcagcaggtgtgttcatgcctgttggcctcgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttccctgcagctgaaatgttacaagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccactcactccttctcagatcagtgttcacattggaatggatgacaggaggagggatccttccaaaccatctccttgggatcagactagccaagtgtccctctcttccttggcttcagacaagctgccgaaacgccatggtctccttgaggaggaaaggggcaagtggtcatcgctcataaatgcagcagatgaagaacagtacatctgaagcactggactcttagtacagggggaaatgttcctccttcccagtcaggggagggactgacttatttcttcaacagcttcagtgttgtacgtgaagtattccttcagctcataagacaattacaactcagctcagtgttgggttgtaaggattgtggattttttttcaggtcaccaggtatttctagttacagaaataatctgtggcactataatgaactggcttgtttgcacacaacgtttagtgaaataatgtaaaattgtaattttcagagtctaaaactgtttctctgtgactctttgctcggaaccaaatttcgtattttttactctttcaaactttattacttcaagaccacatgaagcaaaagtattttcagagctgccaaatattaatttgttctaaatgaaattagcaatggcataatgagctctgtggtcagaagttgagtttttacacagaatcctaactagtcatgtcactgtgagaacactttgtatttaggattcatgtcatctcctgggaccaaaaatgctttgttgtttcacctgctataactctctgaaaggtctttttcaaagattttcacttgctttgaagtgttgcatccttttgatgcacatttctactgctctctttgatttttctcttttgctccatatgagcccttttccccctttttattttcttgcacaagagatcttctatgagttatcattatgtttacagacatttctgtttgggacaaactcctttaagtcaccaggaaccgttccattcctgttgaagtccataaaggtagaacagttcctggtcccagttatccaagatactttgctggaccctggggagctccttagagttggacaattgtcaatctctttcctctgacagagtgaagagtttatgccagtgtgagcaaaggtagtatttaccttggtgtgagtgagcagagctagcactggtgtgactcctgtgtagctgagcagagcgagcttactgcataacataaccccagcttgctggttgcttaaaaagctgctaaaattttaaattatataggtggaaaaatggccctaaagtggacttctgtttgccaccatacaaataaatgacaggacctgaactaaggaaatttgtaatttaaatttgtatttatgttttgcattggttttagttaccctctttacttcaattagaaatcaaagtgctggacaacctttttttgctttaacatctttaccaaagcttgcaataacttcatccctgtggatgtcagattcaccccttagcactttttagagtcaggacagtaggaatcaatagctttggtgcactggttccagtcctaatgcactgtgggactctgatgtaagaagagttttatagtctaattt

//