2025-04-03 19:44:12, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_016223599 3762 bp mRNA linear MAM 11-APR-2016 DEFINITION PREDICTED: Miniopterus natalensis nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), transcript variant X2, mRNA. ACCESSION XM_016223599 VERSION XM_016223599.1 DBLINK BioProject: PRJNA317472 KEYWORDS RefSeq. SOURCE Miniopterus natalensis ORGANISM Miniopterus natalensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yangochiroptera; Miniopteridae; Miniopterus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015505014.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Miniopterus natalensis Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3762 /organism="Miniopterus natalensis" /mol_type="mRNA" /isolate="MN2012-01" /db_xref="taxon:291302" /chromosome="Unknown" /sex="male" /tissue_type="skeletal muscle" /dev_stage="adult" /geo_loc_name="South Africa" /collection_date="Oct-2012" gene 1..3762 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:107545508" CDS 3..2915 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X2" /protein_id="XP_016079085.1" /db_xref="GeneID:107545508" /translation="
MAEEDPYLGGHEQMFHLDPLNHTIFNSEIFQPEMPLPTDVPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKSTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLDYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGGAGAGGGGMYGTGGGGGGAGSTGPGYGFPHYGFPTYSGITFHPGTTKSNAGMKHGTMDTSSKNGPEGCDKSDDREAVSPSGKVTETTEQDKGSGDRDDAVTLTYPVGVKEESSGLQDNLFLEKALQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDCVLHLAIIHLHAQLVRDLLEVTSGLVLDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHEKILSILLKHKKAALLIDNPNGEGLTAIHIAVLSNSMPCLLLLLAAGVDVNAPEQKSGRTALHLAVEQDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRMAALLKAAGADPLLENFEPLYDLDDSWAKDGDDEGVVPGTTPLDMATNWQVFDILNGKPYEPEFTPDDLLAQGDMKQLTEDTKLQLYKLLEFPDPDKNWSTLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELMEALRQMGYTEAIEVIQAAFTSGTAAPSPTKTTTQANSLPLSPASTRQQIDELRDDSICDSGVETSFRKLSFTESLTSGSSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 123..728 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(165..167,171..176,180..185,192..203,426..428, 432..437,726..728) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 747..1052 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(750..752,756..764,768..776,894..902,939..941, 975..977,1032..1034,1041..1043,1047..1049) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(756..761,765..767,804..806,810..812,816..818, 915..920,927..929,933..935) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(819..821,825..827,918..923) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1476..2297 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature 1503..1610 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1629..1727 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1632..1637,1644..1652,1656..1661,1671..1673, 1680..1682,1725..1727,1731..1733,1737..1739,1749..1754, 1761..1769,1773..1778,1788..1790,1797..1799,1824..1826, 1830..1832,1836..1838,1848..1853,1860..1868,1872..1877, 1887..1889,1896..1898) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1731..1826 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1938..1940,1944..1946,1956..1961,1968..1976, 1980..1985,1995..1997,2004..2006,2031..2033,2040..2042, 2046..2048,2058..2063,2070..2078,2082..2087,2100..2102, 2109..2111,2136..2138,2142..2144,2148..2150,2160..2165, 2172..2180,2184..2189,2199..2201,2208..2210,2235..2237) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1938..2033 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2040..2138 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2142..2237 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2436..2660 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
gaatggcagaagaggatccgtatttgggagggcatgaacaaatgtttcatttggatcctttgaatcatacaatatttaactcagaaatatttcaaccagagatgccactgccaacggatgtcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgatatgtctgtgaaggcccgtcccatggtggactccctggtgcatccagtgaaaagaataagaagtcctaccctcaggtcaaaatctgcaactatgtgggacctgcaaaggtgattgttcagttggtcacaaatggaaaaagcacccacctgcatgcacacagcctggtggggaagcactgcgaggatgggatctgcaccgtaactgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcatgtataaggggctataatcccggacttttggtgcatcctgatcttgactatttacaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctctgcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagctttccttccagacagcaccggtagcttcaccaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaatgcgtccaacttgaaaattgtacgaatggacaggacggctggatgcgtaactggaggggaagagatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggaatctgggaaggatttggagatttttccccaacagatgttcatagacaatttgccatcgtcttcaaaacaccgaagtataaagacgtcaacattaccaaaccagcctccgtgttcgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaagcggcagaagctcatgcccaacttctcggacagttttggcggcggtggtggtgccggggctggaggtggaggcatgtacggcactggcggtggaggagggggcgctgggagcaccggcccagggtatggcttcccccactatggatttccaacatacagtggaattaccttccaccctggaaccactaaatctaatgctgggatgaagcatggaaccatggacacctcatctaaaaatggccctgaaggttgtgacaagagtgatgacagagaggctgtaagtccctctgggaaagtaactgaaaccacagaacaagataaggggtctggagatagggatgatgcggttactctgacgtatccagtgggagtaaaggaagagagctctgggcttcaggataatctcttcctagagaaggctctgcagcttgccaagcggcatgccaacgccctgttcgactacgcggtgacaggagatgtgaagatgctgctggctgtgcagcgccatctcactgccgtgcaggatgagaacggggactgtgtcctacacttagcaatcatccaccttcatgctcagcttgtgagggatctgctagaagtcacatctggtttggttttggatgacattatcaacatgagaaatgatctctaccagacgcccttgcacttggcagtgatcaccaagcaggaggctgtggtggaggacttgctgagggctggggccgacctgagcctcctggaccgcttgggtaactcggttttgcacctagctgccaaagaaggacatgagaaaattctcagtattttactcaagcacaaaaaggcagcactacttatcgacaaccccaatggggaaggtctgaccgccatccacatagccgtgctgagcaacagcatgccgtgtctgctgctgctgctggctgccggggtggacgtgaacgcgccggagcagaagtcgggccgcacggcgctgcacctggctgtggagcaggacaacatctccttggccggctgtctgctcctggagggtgatgcccatgtagacagtaccacctatgatggaaccacacccctgcacatagcagccgggagaggctccacccggatggcagctcttctcaaagcagcaggagcagatcccctgctggagaactttgagcctctctatgacctggatgactcttgggcaaaggatggagatgatgaaggagttgtgcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaaaccatatgagccagagtttacacctgatgatttactggcacaaggagacatgaaacagctgactgaagatacaaagctgcagctctacaagttgctagaatttcctgatccagacaaaaactggtctactctggcccagaaattaggtctggggatactcaataatgccttccgcctgagtcccgcgccttctaaaactctcatggacaattacgaggtctctggaggaacaataagagagctgatggaggccctgagacagatgggctacaccgaagcgatcgaagtgatccaggcagccttcacctcaggaacggcagcccccagcccaaccaagaccaccactcaggccaactcgctgcctctctctcctgcctccacaagacagcaaatagatgagctgcgagacgacagcatctgtgacagcggtgtggagacatccttccgcaaactcagcttcacggagtctctgaccagcggcagctcactgctgactcttaacaaaatgccccatgattacgggcaggaaggacctctagaaggcaaaatttagccctcagcagtttccaacatcctgtaaaccaaagttgtgagattccattggcttgtccgaaagaaggaaggtgaggcgcctccaggggcgctcagaggaacaccgcggacctggacggtctggacccctccaggcctttgaaacctggcttcctttcttggctcttaaatgactttcagttcggctcacttgcagatagtatctagcggtcgcagccttcggcgggccggtgcctcggaggcaccatgtggagctttaccagctgctttctgttgtcactgctgctgcgtcccaccgtcattaaacgattaacagtccccacctggtgtccttactagccgtccatagcacagtcatgttttcagattaagaattaaggaaattcttaatattttattaagaaaattcttaatattttattaagaatattttaaatgaggtattttaaaatgagggtctatgtataattaaaaaaggcttcctgctttttctaatgtgttttatctctgatttgaaaaaagaacaggtatgtgtcaatatttaaacatgattacaatcagtgctgaaaatggtattttcccctttttctgcattttgctattgtaaatatgtttttagatcaaatactttaaaagaaaaaatgttggatttataaatgctattttttattttacttttataataaaaggaaaagcaaattgatggccttgtcttgttggctctgtactactactttccttgtaaatacgggaccgttccacatcctggttattatattcacctccctgcagagcccattttttgatccagaaataaaaattgtccaaagaaaagtgctttaacctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]