2025-04-03 19:44:13, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_016223598 3765 bp mRNA linear MAM 11-APR-2016 DEFINITION PREDICTED: Miniopterus natalensis nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), transcript variant X1, mRNA. ACCESSION XM_016223598 VERSION XM_016223598.1 DBLINK BioProject: PRJNA317472 KEYWORDS RefSeq. SOURCE Miniopterus natalensis ORGANISM Miniopterus natalensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yangochiroptera; Miniopteridae; Miniopterus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015505014.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Miniopterus natalensis Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3765 /organism="Miniopterus natalensis" /mol_type="mRNA" /isolate="MN2012-01" /db_xref="taxon:291302" /chromosome="Unknown" /sex="male" /tissue_type="skeletal muscle" /dev_stage="adult" /geo_loc_name="South Africa" /collection_date="Oct-2012" gene 1..3765 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:107545508" CDS 3..2918 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X1" /protein_id="XP_016079084.1" /db_xref="GeneID:107545508" /translation="
MAEEDPYLGGHEQMFHLDPLNHTIFNSEIFQPEMPLPTADVPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKSTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLDYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGGAGAGGGGMYGTGGGGGGAGSTGPGYGFPHYGFPTYSGITFHPGTTKSNAGMKHGTMDTSSKNGPEGCDKSDDREAVSPSGKVTETTEQDKGSGDRDDAVTLTYPVGVKEESSGLQDNLFLEKALQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDCVLHLAIIHLHAQLVRDLLEVTSGLVLDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHEKILSILLKHKKAALLIDNPNGEGLTAIHIAVLSNSMPCLLLLLAAGVDVNAPEQKSGRTALHLAVEQDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRMAALLKAAGADPLLENFEPLYDLDDSWAKDGDDEGVVPGTTPLDMATNWQVFDILNGKPYEPEFTPDDLLAQGDMKQLTEDTKLQLYKLLEFPDPDKNWSTLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELMEALRQMGYTEAIEVIQAAFTSGTAAPSPTKTTTQANSLPLSPASTRQQIDELRDDSICDSGVETSFRKLSFTESLTSGSSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 126..731 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(168..170,174..179,183..188,195..206,429..431, 435..440,729..731) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 750..1055 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(753..755,759..767,771..779,897..905,942..944, 978..980,1035..1037,1044..1046,1050..1052) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(759..764,768..770,807..809,813..815,819..821, 918..923,930..932,936..938) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(822..824,828..830,921..926) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1479..2300 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature 1506..1613 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1632..1730 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1635..1640,1647..1655,1659..1664,1674..1676, 1683..1685,1728..1730,1734..1736,1740..1742,1752..1757, 1764..1772,1776..1781,1791..1793,1800..1802,1827..1829, 1833..1835,1839..1841,1851..1856,1863..1871,1875..1880, 1890..1892,1899..1901) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1734..1829 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1941..1943,1947..1949,1959..1964,1971..1979, 1983..1988,1998..2000,2007..2009,2034..2036,2043..2045, 2049..2051,2061..2066,2073..2081,2085..2090,2103..2105, 2112..2114,2139..2141,2145..2147,2151..2153,2163..2168, 2175..2183,2187..2192,2202..2204,2211..2213,2238..2240) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1941..2036 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2043..2141 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2145..2240 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2439..2663 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
gaatggcagaagaggatccgtatttgggagggcatgaacaaatgtttcatttggatcctttgaatcatacaatatttaactcagaaatatttcaaccagagatgccactgccaacggcagatgtcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgatatgtctgtgaaggcccgtcccatggtggactccctggtgcatccagtgaaaagaataagaagtcctaccctcaggtcaaaatctgcaactatgtgggacctgcaaaggtgattgttcagttggtcacaaatggaaaaagcacccacctgcatgcacacagcctggtggggaagcactgcgaggatgggatctgcaccgtaactgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcatgtataaggggctataatcccggacttttggtgcatcctgatcttgactatttacaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctctgcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagctttccttccagacagcaccggtagcttcaccaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaatgcgtccaacttgaaaattgtacgaatggacaggacggctggatgcgtaactggaggggaagagatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggaatctgggaaggatttggagatttttccccaacagatgttcatagacaatttgccatcgtcttcaaaacaccgaagtataaagacgtcaacattaccaaaccagcctccgtgttcgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaagcggcagaagctcatgcccaacttctcggacagttttggcggcggtggtggtgccggggctggaggtggaggcatgtacggcactggcggtggaggagggggcgctgggagcaccggcccagggtatggcttcccccactatggatttccaacatacagtggaattaccttccaccctggaaccactaaatctaatgctgggatgaagcatggaaccatggacacctcatctaaaaatggccctgaaggttgtgacaagagtgatgacagagaggctgtaagtccctctgggaaagtaactgaaaccacagaacaagataaggggtctggagatagggatgatgcggttactctgacgtatccagtgggagtaaaggaagagagctctgggcttcaggataatctcttcctagagaaggctctgcagcttgccaagcggcatgccaacgccctgttcgactacgcggtgacaggagatgtgaagatgctgctggctgtgcagcgccatctcactgccgtgcaggatgagaacggggactgtgtcctacacttagcaatcatccaccttcatgctcagcttgtgagggatctgctagaagtcacatctggtttggttttggatgacattatcaacatgagaaatgatctctaccagacgcccttgcacttggcagtgatcaccaagcaggaggctgtggtggaggacttgctgagggctggggccgacctgagcctcctggaccgcttgggtaactcggttttgcacctagctgccaaagaaggacatgagaaaattctcagtattttactcaagcacaaaaaggcagcactacttatcgacaaccccaatggggaaggtctgaccgccatccacatagccgtgctgagcaacagcatgccgtgtctgctgctgctgctggctgccggggtggacgtgaacgcgccggagcagaagtcgggccgcacggcgctgcacctggctgtggagcaggacaacatctccttggccggctgtctgctcctggagggtgatgcccatgtagacagtaccacctatgatggaaccacacccctgcacatagcagccgggagaggctccacccggatggcagctcttctcaaagcagcaggagcagatcccctgctggagaactttgagcctctctatgacctggatgactcttgggcaaaggatggagatgatgaaggagttgtgcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaaaccatatgagccagagtttacacctgatgatttactggcacaaggagacatgaaacagctgactgaagatacaaagctgcagctctacaagttgctagaatttcctgatccagacaaaaactggtctactctggcccagaaattaggtctggggatactcaataatgccttccgcctgagtcccgcgccttctaaaactctcatggacaattacgaggtctctggaggaacaataagagagctgatggaggccctgagacagatgggctacaccgaagcgatcgaagtgatccaggcagccttcacctcaggaacggcagcccccagcccaaccaagaccaccactcaggccaactcgctgcctctctctcctgcctccacaagacagcaaatagatgagctgcgagacgacagcatctgtgacagcggtgtggagacatccttccgcaaactcagcttcacggagtctctgaccagcggcagctcactgctgactcttaacaaaatgccccatgattacgggcaggaaggacctctagaaggcaaaatttagccctcagcagtttccaacatcctgtaaaccaaagttgtgagattccattggcttgtccgaaagaaggaaggtgaggcgcctccaggggcgctcagaggaacaccgcggacctggacggtctggacccctccaggcctttgaaacctggcttcctttcttggctcttaaatgactttcagttcggctcacttgcagatagtatctagcggtcgcagccttcggcgggccggtgcctcggaggcaccatgtggagctttaccagctgctttctgttgtcactgctgctgcgtcccaccgtcattaaacgattaacagtccccacctggtgtccttactagccgtccatagcacagtcatgttttcagattaagaattaaggaaattcttaatattttattaagaaaattcttaatattttattaagaatattttaaatgaggtattttaaaatgagggtctatgtataattaaaaaaggcttcctgctttttctaatgtgttttatctctgatttgaaaaaagaacaggtatgtgtcaatatttaaacatgattacaatcagtgctgaaaatggtattttcccctttttctgcattttgctattgtaaatatgtttttagatcaaatactttaaaagaaaaaatgttggatttataaatgctattttttattttacttttataataaaaggaaaagcaaattgatggccttgtcttgttggctctgtactactactttccttgtaaatacgggaccgttccacatcctggttattatattcacctccctgcagagcccattttttgatccagaaataaaaattgtccaaagaaaagtgctttaacctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]