GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-24 19:52:46, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_016189883            3609 bp    mRNA    linear   MAM 11-APR-2016
DEFINITION  PREDICTED: Erinaceus europaeus NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), mRNA.
ACCESSION   XM_016189883
VERSION     XM_016189883.1
DBLINK      BioProject: PRJNA232766
KEYWORDS    RefSeq.
SOURCE      Erinaceus europaeus (western European hedgehog)
  ORGANISM  Erinaceus europaeus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Insectivora; Erinaceidae;
            Erinaceinae; Erinaceus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006804240.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Erinaceus europaeus Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3609
                     /organism="Erinaceus europaeus"
                     /mol_type="mRNA"
                     /isolate="Erinaceus europaeus_13Jul2011"
                     /db_xref="taxon:9365"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="New Zealand"
     gene            1..3609
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 14 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:103116885"
     CDS             39..3509
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_016045369.1"
                     /db_xref="GeneID:103116885"
                     /translation="
MALFPAFAAASEAPENGSAGKELDWLRNPSFCVGAITSLSQQTEEATTLVSEQLIPARISLKSESSGESDSSKKLRQASRKKKKEKKKKRKHQHHKKTRRHEQPSSSDSNSDTDSEKGRSSRGIRDHKKESEKPHQENNATADTGRRLVWLEDIQALTGDTFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGTSTQKKHSHKPVERYFTKKNVGLVNMDGIAISGQTEPPSSEPVSFIPLPSSEDVAHPVTSWLNPLGIYDQSTTQRLQGHGPSEQEVKQQDAQPDRESALLKAKVEEFNRRVRETPRDIQLWMAFVAFQDEVMRSPGLYAIEEGEREKRKRSLKLTLEKKLAILERAIESNQSSVELKLAKLKLCAEFWEPSSLVKEWQKLIFLHPNNTALWRRYLLFCQSQFSTFTVSKIHSLYGKCLSTLSAVHDGSILSHPALPGTEEAMFALFLQQCHFLRQAGHTEKTISLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMHQQERGGWVIISPDEEEDEPEDDDQEIRDKTLPRWQIWLAAERSRDQRHWRPWCPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSPDLQFQLITAFLQFLGVPSGVSPPASCLYLAMDENSVFDHGLCDEKPLTFLDLSFSGISCVGRLDPWGCQRWTRGHKQEGEEFIRNLFHLVMPLFSGKERSQLCFSWLLYETAKVIWCLHTKNKKRLKSQGKNCKKLAKNLLKEMENRNDFCLWRQYAHLEWLLGNMEEARKVFDTALSIAGGRGLQDADLCELSLLYAELEVELEPDLRRATPGRAVHILTRLAESRPYEPYSGQVLAVHILKARKAYERALQDCLGESCVLHRLVSVVRCFLLFQYLTVGINAATQTYKQMFAKLKEAASVDGAGLEDSAGPRAPSRVLEAVTLTHTSLLRLHMKVSVYPLAPLRQALSEALTMYPSNPMLWRAYVQIQNKSHSASQTRRFFSAITRSTTALEPWLFAIEAEKMRRRLVETIQRIDGKEVHITIPETGLTHRIKGLFENAIRSDSGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYLDAVEYFPDEMQEILDLMTEKELRVRLPVEELDLLLED"
     misc_feature    975..1973
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
catttctgcggcggtgactggcgctgaggcctgtggtcatggcgctgttccctgcctttgcggccgccagcgaagctccagagaacgggagcgccgggaaggaattagactggctgagaaacccaagcttctgtgttggagccatcacttccttgagccaacaaacggaagaggccacaactcttgtttctgagcagttgataccagcaagaatttccctgaaatcagagtcttcaggtgaaagtgatagtagcaaaaagctcagacaagcaagcaggaaaaagaagaaagagaaaaagaaaaaaaggaagcatcagcaccacaagaaaaccaggagacatgagcagcctagtagcagtgactctaactcagatactgactctgaaaagggcagatcttccagaggcatcagagaccataagaaagaatccgagaaaccacatcaggaaaacaatgccactgctgacactggacgtcggttggtttggcttgaagacattcaggctctgactggagacaccttcagaacagacaagaaaccggatcctgccaactgggagtataaatctctctaccgaggagatatagcaagatacaagaggaaaggagactcctgccttggcattaacccgaagaaacagtgtatatcttgggaagggacttctacacagaagaagcactcacacaagcctgtggaacgctatttcacaaagaagaatgtggggttagtgaacatggatggcattgccattagcggtcagacggagcctccctcctcagagccagtctctttcattccactgccgagctcagaggatgtggcgcatcctgtcacaagctggctgaaccctctgggtatttatgatcagtccaccactcagaggctacaagggcacggtccctcagagcaagaggtgaagcagcaagacgctcagcccgaccgagagagcgcacttctcaaggccaaggtggaagaatttaacaggagggttcgggagacacctcgggacatccagctgtggatggcgttcgttgctttccaggatgaggtcatgagaagtcctggcttatatgccatcgaggaaggagagcgggagaagcggaagaggtcgctgaagctgaccctggagaagaagctggccattctggagcgggccatcgagagcaaccagagcagcgtggaactgaagctggccaagctcaagctctgcgcggagttctgggaaccctcttccctggtcaaagagtggcagaagctgatattcttacaccccaacaacacagccctctggcggagataccttttgttttgccagagccagttcagcacctttacggtgtcaaagattcacagcctgtatggcaaatgcctgagcacgctgtccgccgtgcacgatggcagcatcttatcacaccctgccctgcccggcaccgaggaggccatgtttgctctctttcttcagcagtgccacttcctccggcaagctgggcacacggagaagaccatctctttgttccaggccatggttgatttcaccttcttcaagcccgacagtgtgaaagacctgcccaccaaaggacaggtggagttctttgagcccttctgggacagtggagagcctcgggctggtgagaagggcgcacggggctggcgggcctggatgcaccagcaggaacgtggcggatgggtgatcatcagcccagatgaggaggaggatgagccagaagatgatgaccaggaaataagagataagacgctgcccaggtggcagatctggcttgctgcggagcggtcccgagaccagaggcactggcggccatggtgcccggataagaccaagaagcagactgaggaagattgtgaggatccagagaggcaggtgctgtttgatgatattgggcagtctctcatccgactctccagccctgatctacagttccagctgatcacggccttcctgcagttcctgggtgtgccttctggcgtcagtcccccagcctcctgtctctatctggccatggatgagaacagtgtctttgatcacggactttgtgacgaaaagccattgacttttcttgacctttccttctctggcatcagttgtgttggccgcctggacccgtggggctgccagcgctggaccaggggccacaagcaggagggcgaggagttcattcgcaacctcttccacctggtgatgccattgttctctggcaaggagaggtctcagctctgcttctcctggctgctgtatgagactgcaaaggtcatctggtgcctgcatacaaaaaacaagaagaggttaaagtcacaaggaaagaactgcaaaaagctagccaagaatctcctcaaggagatggagaaccgcaacgacttctgtctgtggaggcagtatgcccacctggaatggctgttaggcaatatggaagaggccaggaaggtgttcgacacggccctcagcatagcagggggcagggggctgcaggacgccgacctctgtgagctcagcctgctctatgctgagctggaggtggagctggagccggacttgaggagggccacccccggccgcgccgttcacatcctgaccaggctggctgagagcaggccctacgaaccctacagtgggcaggtcttggccgtccacattctcaaagcccggaaggcctacgagcgtgcgctgcaggactgcttgggtgagagctgtgtcttgcaccgcctggtgagcgtggtcagatgcttcttgctcttccagtatttgactgtcgggatcaatgctgccacgcagacctacaagcagatgtttgccaagctgaaggaggctgcttccgtggatggtgctgggctggaggacagcgcaggccctcgggctcccagccgggttctcgaggcggtcaccctgacacacacaagcctgctccggctacacatgaaggtcagcgtgtaccctctggcacccctgcgccaggccctctcagaggccttaacgatgtaccccagcaacccgatgctctggagggcgtacgtacagatccagaataagtcccacagtgccagccagaccagaagattcttcagtgccatcaccaggtctaccacagccttggagccttggttgtttgcaattgaagctgagaaaatgaggagaagactggtggaaactattcagaggatagatggcaaagaagtccatatcacaatcccggagactggcctgacacatcgcatcaaagggctctttgaaaatgcaatacggagcgacagtggcagccagtgccccttactgtggagaatgtacctgaattttctggtttccttaggaaataaagaaagaagcaaaggtgtattttataaagcacttcagaattgtccctgggcaaaggtgttgtacctggatgctgtggagtacttccctgacgagatgcaggagatcctggaccttatgaccgagaaagagctccgggtgcgcctgcctgtggaggagctggaccttctgctggaggactagagaccaggaggcacactcaagctgggatgtgagcccgtgttgagacctccattctggtggaagtttcttgatatgatttgtgtctggttaccagtcttac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]