GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 18:53:53, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_015894708             585 bp    mRNA    linear   INV 14-MAR-2016
DEFINITION  PREDICTED: Acropora digitifera C-type lectin domain family 17,
            member A-like (LOC107330065), mRNA.
ACCESSION   XM_015894708
VERSION     XM_015894708.1
DBLINK      BioProject: PRJNA314803
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Acropora digitifera
  ORGANISM  Acropora digitifera
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Astrocoeniina; Acroporidae; Acropora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015442571.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Acropora digitifera Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 10% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..585
                     /organism="Acropora digitifera"
                     /mol_type="mRNA"
                     /db_xref="taxon:70779"
                     /chromosome="Unknown"
                     /country="Japan:Okinawa, Kunigami, Oku"
     gene            1..585
                     /gene="LOC107330065"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 91% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:107330065"
     CDS             118..585
                     /gene="LOC107330065"
                     /codon_start=1
                     /product="C-type lectin domain family 17, member A-like"
                     /protein_id="XP_015750194.1"
                     /db_xref="GeneID:107330065"
                     /translation="
MAPPGLSWCVLILVVLVSECYSSDGEKACSCYTFENRERRDAFSWPRAREWCESNNKSLVVMETIEEWEFINSSLKDQIGNALKEWHIGLVINLTTGNWSWINGKPLTFDKWQPYKPGQSDLYVLIAKEFPTGSFGSFNSIRGGLTTIIQGDRGE"
     misc_feature    202..>480
                     /gene="LOC107330065"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
ORIGIN      
cctcagtcacgccttttcaaggcggaattgtcatgaatgcaggtcatttggtaaccacttcggtcagttgttttacggccacaacttgaaagaaagaaccttaccacgaatcaacgaatggctccgccaggactatcatggtgtgttctcattttggtggttttagtatctgagtgctattcttcggatggagagaaagcctgctcatgctacacatttgagaatcgtgagaggagagacgcattttcatggccacgagcaagagagtggtgtgaatctaacaataaatcgcttgttgtcatggagacaatagaagagtgggagttcatcaacagcagcttgaaggatcaaataggaaatgctttaaaggaatggcacataggactggtgataaacctaactactggcaattggagttggatcaatggcaaacctttgacttttgataaatggcaaccttacaaaccaggtcaaagtgacctttatgttctgattgcaaaagagtttcccactggttcctttggatcctttaacagcataagaggtggtttaactacgattatacagggagaccgtggagagtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]