2024-04-26 04:18:07, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_015824155 3017 bp mRNA linear VRT 23-MAY-2019 DEFINITION PREDICTED: Protobothrops mucrosquamatus argonaute RISC component 4 (AGO4), mRNA. ACCESSION XM_015824155 VERSION XM_015824155.1 DBLINK BioProject: PRJNA313429 KEYWORDS RefSeq. SOURCE Protobothrops mucrosquamatus ORGANISM Protobothrops mucrosquamatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Toxicofera; Serpentes; Colubroidea; Viperidae; Crotalinae; Protobothrops. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015388239.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Protobothrops mucrosquamatus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3017 /organism="Protobothrops mucrosquamatus" /mol_type="mRNA" /isolate="PMUCROS" /db_xref="taxon:103944" /chromosome="Unknown" gene 1..3017 /gene="AGO4" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 42 Proteins, and 97% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:107294886" CDS 81..2465 /gene="AGO4" /codon_start=1 /product="protein argonaute-4" /protein_id="XP_015679641.1" /db_xref="GeneID:107294886" /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQMLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHHDTQHTMYFA"
misc_feature 90..344 /gene="AGO4" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 375..527 /gene="AGO4" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 528..890 /gene="AGO4" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(684..686,729..731,771..773,783..785,837..839, 858..860,864..866) /gene="AGO4" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1029..2336 /gene="AGO4" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1440..1442,1452..1454,1488..1499,1506..1508, 1530..1532,1539..1541,1551..1553,1563..1565) /gene="AGO4" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1644..1646,1650..1652,1890..1892,2304..2306) /gene="AGO4" /note="active site" /db_xref="CDD:240015" ORIGIN
aaattgatgtttatcattatgacgtggatatcaaaccagaaaaacgtccccggagagtgaatagggaggttgtggatactatggtgagacacttcaagatgcaaatatttggggatcgacagcctggctatgatggcaaaagaaatatgtatactgcgcatcctttgcctattggaagagacagggtggatatggaggtcacactcccgggcgaagggaaggaccagacctttaaagtgtcagttcagtgggtgtctgtagtcagccttcagatgctcctggaagctttggcagggcatctgaacgaagtcccagaagactctgtgcaggcattagatgttatcacacggcatcttccctctatgaggtacactccagtggggcgttccttcttctctccccctgaaggatactaccacccgctgggaggaggccgagaggtctggtttggcttccatcagtctgtcagacctgccatgtggaacatgatgctcaatatagatgtatcggcaactgctttctaccgtgctcagcctattattgaattcatgtgcgaggtcctggatattcaaaacatcaatgaacaaacgaaaccccttacggattcccagcgtgttaaatttaccaaagaaatcagaggtttaaaagtggaggttactcactgcggtcagatgaaaagaaaatacagagtttgcaatgttactagacgacctgcaagccatcaaacgttccctctgcagttggaaaatgggcaagctatggaatgtacagtagctcagtactttaagcagaagtacagtctgcaactgaaatacccacatcttccatgcctccaagtagggcaagagcagaaacatacatatctaccccttgaggtgtgtaatatagttgcaggacagcgctgtattaagaagctgacagacaatcagacatcaactatgatcaaagcaacagcacgatctgcacctgacaggcaggaggaaattagcagacttgtcaagagtaacagtatggttggcggacctgatccatatctgaaggagtttggtattgttgtccataatgaaatgacagaactgacaggcagagtattacctgcacctatgctgcagtatggaggtaggaacaagactgttgctacaccaaatcagggtgtctgggatatgagaggaaaacagttctatgctggcattgaaattaaagtgtgggctgtcgcttgctttgcacctcagaaacaatgtcgggaagatttgctgaagagttttactgatcagctgcgcaagatctctaaggacgcggggatgccaatccagggccagccatgcttctgtaaatacgcacaaggggcagacagcgtggagcccatgttcaaacatttgaaattgacttatgtggggctgcagctaattgtagtcattcttccaggaaagacacctgtctatgctgaagttaaacgagtcggggataccctcctgggcatggccacccagtgtgttcaggtgaaaaatgtggtgaaaacatctccccaaacactgtccaatctttgtctcaagatcaacgcaaaacttggtggaataaacaatgtccttgtaccacatcaaaggccctcggtattccagcaacccgttatttttctgggagcagatgtcactcacccacctgctggagatgggaagaaaccttccattgctgctgtagtcggaagcatggatggccaccccagccgctactgcgctactgtgcgagtgcaaacatcccgccaagagacatcccaggaactgctgtacagtcaggaagtgattcaggacctgaccaatatggtgcgagaactgctgatccagttttacaagtccactcgcttcaagcccacacggatcatttactatagaggaggagtatccgaagggcaaatgaaacaggtagcttggcctgagcttattgcgatccggaaggcctgcatcagtttagaagaagactaccgaccaggaatcacctacattgtcgtgcagaaaaggcatcacacgagactcttttgtgcagacaaaactgaacgggtggggaaaagtggaaatgttccggcaggtactaccgtggatagcaccatcacccacccatctgaatttgacttttacctctgtagccatgcaggaatccagggaaccagccgtccttctcactatcaagtcttgtgggatgacaactgtttcaccgcggatgaattgcagctactgacataccagctgtgtcacacttacgtgcgatgcacgcggtctgtctcaatccctgcgcctgcatattacgctcggctagtggcattcagagcaagataccatctggtagacaaagaccacgacagtgctgaaggcagccacgtgtcaggacagagcaatggccgtgaccctcaagcactagccaaggcagtgcaaatccaccacgacacccagcacactatgtattttgcctgataggactctgcagccacgtggcaggagtggcctagttggtcaggccaccaaccatccgtagtcagggctcgtttttaacgcaggctgccctccaccagcagcttgggacagttgcactgaattgattcctgcagccaacatcttgtgcaggcacaattgagccatttttattttattcccttccgtaaacagaaatttcataaacggtctttgcattgaactgaatttttacctcaaaatgcaaaaggctgatcctcttaaaaaacaatttttttaaaggacttggcacgaaaggtttttattgaaatattttgctaatcagttaatcaatttacgttacctcttcatcccatgttaagcttgtcaagaagattaattccttctgggctttgatatatggcttagtgagtctccagatacggcaaaacaggattccgctgttttttctgtctggggccatatagacttgatcaatgaatttttggtgtaagacacccttccacaaacatgaattttcagaggtatggctgttcctttggttctgttttttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]