2024-04-27 02:29:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_015244304 6895 bp mRNA linear MAM 22-NOV-2019 DEFINITION PREDICTED: Vicugna pacos ATPase copper transporting beta (ATP7B), transcript variant X1, mRNA. ACCESSION XM_015244304 VERSION XM_015244304.2 DBLINK BioProject: PRJNA221631 KEYWORDS RefSeq. SOURCE Vicugna pacos (alpaca) ORGANISM Vicugna pacos Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda; Camelidae; Vicugna. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_021964184.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process On Nov 22, 2019 this sequence version replaced XM_015244304.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Vicugna pacos Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6895 /organism="Vicugna pacos" /mol_type="mRNA" /isolate="Carlotta (AHFN-0088)" /db_xref="taxon:30538" /chromosome="14" /map="unlocalized" /sex="female" /tissue_type="blood" /dev_stage="adult" gene 1..6895 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 mRNAs, 9 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:102544967" CDS 335..4897 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X1" /protein_id="XP_015099790.1" /db_xref="GeneID:102544967" /translation="
MERAGGEKSGSPEPSFLATLADPQVTLLSVHKRWSFRRSPGARGSIRPVTSEEEGCRPEEGGFSQKVLNGTQEIGSDQILSKLPWTARAWEPEMKQSFAFDNTGYEDGLDGMYPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVAEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMSLGLIDVRRLQSAHPKVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRHSPGPPQGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQRISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENCSSNHVGNYSAESSTGQAGPPRSVQEAAPRPGGLPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDCAGSDGDLELIITGMTCTSCVHNIESILTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFTDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQSEQTAHLNGVSSVPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPELEWYAAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYISQVSLSSLKSDKLSRHSTAASDRGDKWSLLLNDRDEEQCI"
misc_feature 695..886 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(713..721,728..730) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 950..1138 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(968..976,983..985) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1301..1468 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1310..1318,1325..1327) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1589..1780 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1607..1615,1622..1624) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1973..2161 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1988..1996,2003..2005) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2198..2389 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2216..2224,2231..2233) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2453..4561 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3446..3448,3452..3454,4490..4492) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3578..3586,3788..3790,3941..3949,4037..4039, 4157..4165,4223..4225,4232..4234,4241..4243,4298..4300, 4307..4309) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" misc_feature 3578..3598 /gene="ATP7B" /note="P-type ATPase signature motif; other site" /db_xref="CDD:319783" misc_feature 3578..3580 /gene="ATP7B" /note="phosphorylation site [posttranslational modification]" /db_xref="CDD:319783" ORIGIN
ggtggccgggcgtccaagcagttctgcgtgtgcgaggggctgtgtacagagattcctagggccaaataaatgcagtgtgatgagtaagaggatgccagttggtttgaggggtgtagataaacaagagcaaatatacatacagcagtgtgcagcctgccctggttcctggaagcctggctggcagcctccccgggctggctcaggggcagggcagcaggtgcctccccctcactagttaggaagacgcttttcaagcgttttcttctgacgtgaccaaatagcccgaagacgaactgctgttgcggcaggtggaggtgtcactgtggacttggcgatggagagagctgggggcgagaagtctgggagccctgagccgtccttcctggcgactctggctgacccacaggtgaccctgttgtctgtccacaaacggtggtccttcaggagaagccctggagcgagaggctccatcaggccagtgacttcggaggaggaaggctgtcgtcctgaggagggaggattttcacagaaggttttgaatggaacacaggagatcggttccgatcagatcctgtctaagcttccctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtacccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcatgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggccgtgaagtacgtgccgtcagtcctgagcctacctcaggtttgcagtcacatcgaggacatgggcttcgaagccagtgtggcggagggaaaggctgcctcctggccgtacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtctcgctcggcagccgggaggcggtcatcacttaccagccttaccttattcaaccacaagagctcagagaccatgtaaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgagcctgggactgatcgatgtcagacggctgcagagcgcccacccaaaggtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatggaatgcactgtaagtcttgcgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcacgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccactcccccgggcccccccagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagcggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagtgcagaagaactccgagctgccgtggaggacatgggatttgaggcatccgtcctggctgaaaactgttccagcaaccatgttgggaactacagtgctgagagttccacggggcaggctggcccccccaggtctgtgcaggaggcagctccccgccctgggggactccctgaaaaccacaaccccggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgcgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccgggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactgcgcgggctcggacggcgacctggagctgatcatcacagggatgacctgcacctcctgtgttcacaacatagagtccatactcacaaggacaaatggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgttcggcatccctgtcatgggtttaatgatctacatgttgatacccagcaatgagccgcacgagtctatggtcctggaccacaacatcatcccaggactgtccattctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcatcgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacactcctcccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacctcagaagcccttgccaaactcatgtctctgcaagccacagaagccaccgtcgtgactctcggtgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgtggcgataccatcaaggtcgtccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagttggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacatcggtggtatggattgtaatcggttttaccgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcgttccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacgctgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgcggaatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagagcgaacagaccgctcacctgaatggggtcagcagcgtccccgtggaaacagatgcggccccacagaccttctctgtgctgatcggaaaccgagagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacactgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagccagagccatcgccacccaggttggcatcaacaaagtcttcgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaacgaggggaagagggtcgccatggtgggcgacggggtcaacgactccccagccctggcccaggccgacgtgggcattgccatcgggacgggcacggatgtcgccatcgaagcggctgacgtcgtcctcatcagaaacgacctgctcgacgtggtggccagcattcacctctccaagaggactgtgtggagaatccgcctcaacctggtgctggcgttgatctacaacctggtcggaatacccatcgcagcaggtgtcttcatgcccatcggcatcgtgctgcagccatggatgggctcggcagctatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctataagaagccggagctggagtggtacgcagcacaggcacagggccgcatgaagcccctgactgcgtcccaggtcagcgtgcacatcggcatggacgaccggcggcgggactccccccgggccacaccctgggaccaggtcagctacatcagccaggtgtccctgtcctccctcaagtccgacaagctgtctcggcacagcactgcggccagtgacagaggggacaagtggtctctgctcctgaatgaccgggatgaggagcagtgcatctgaaagccacaggcaggcgcagaccccggccggcctggcccccctccccgtggccgaggctcgagcccagcaggcgtggcaccagcggccggcagcagggttgtggggcccctctccagccctggtgcttccgctccccgggcctccttgatcatcccgtcctgggcacgtggacggcgctgcctggccccacgggctcaggggaggcgtcctcccccgtgctgtggcggggcttgtcagaagcctgctgggacagccagccctctgctcagcctctgctttagcatttgggatgactgctcgtgacacgaggaagacctcatcaggaccaggaccttagccaggcctttccatggagctaataaaaacctcggggtcgggctcttttttgacgacacccacgtgcaacgtgtatctgagaccagtttacctcaagtgcacccattgtgctctgctggcaccgcctctcccttttctgcccttgacactgggggtgtggcaccccatcatccgaggccagggctgccgtcctcgcttccccgctgctgttctcgggtgcctctccgaggggctcgagtgctcctgcccgcgccccccaactcacacgcccgccggagagctcgccacacgtcctcagggcgagaagagttctttcttgctgctgagcctcttctctgtggagtcgtggcttctcactctgcagaaccgagtgctgttgctgattgtcgctgcccagctggagtgaggtctcagaacctgagacttgagaaatttgtcttcctgtgggatccaggtagacggaccccgggaggcctgtggtgcaggaacctgctggcccagttcctggggcttcagttacatggcctcacagggtccaatacagaattcatggaggtagtaccccaatgtgcagctccgaggaagtggtacccaaataagagagaggacaccccagtcctccacgtgctttgacttctgcacgctgagctggtgccttaggaaaggggtgaccacaacttcccaagggagagtctttctaacttgcagtggcctttgtggttgcatgacattggaggggcaggaacagggccattgtagactctgaggtcggtggtgattggcagaccacacaggggaagactagtatgatcagaatcttagaacaggcagagcagagcctgttcccagttctgagatgaagcctttgtcacacacacacagtcatttgagttatttattaagtgtcagctattttccagggggatacaaacactatttataaattacctctaatcctcccaacaaaccagcaaagtagataatgtccacgtttcacaggggggaacgggctcagagaggctagtgatcttgcccagaatcacacagccagtgtataggccagagcaggggtctgaatccacgtctattggctctgaagtcttttctccaactggcctctacttgaatagtttgcttgataagaatgaacaaggaaaaggcgcttgcacctggaagaagggatctgccaggtgatagattcatggacttggagtgaaattcaatcacaaggtcgtgtcaccttccctcgggatggttcctttccatttccatacagtttagtttttgctgggtcttactctctaaaaatccatgcacagcgctttgttgtgcttttactttccagtcctctctcccctcccagccccttcctgctctgtccccagtcttgtcctctctttactcttggctgtgctgggggtgtttcttgttttgtaactaggctggtcattgtctgaagaatctaattgtattgatttttcaaaaagcttttaggaccataaatgtcatgtttatggggacacaagaatatttatataattgtacggaaaataaccttttagatgttcaaagtataaggaatttttggtcagaaaagaattcctacttcagaaactttccatgctatattagaataaattttctttttttattcatctaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]