GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 02:29:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_015244304            6895 bp    mRNA    linear   MAM 22-NOV-2019
DEFINITION  PREDICTED: Vicugna pacos ATPase copper transporting beta (ATP7B),
            transcript variant X1, mRNA.
ACCESSION   XM_015244304
VERSION     XM_015244304.2
DBLINK      BioProject: PRJNA221631
KEYWORDS    RefSeq.
SOURCE      Vicugna pacos (alpaca)
  ORGANISM  Vicugna pacos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
            Camelidae; Vicugna.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021964184.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 22, 2019 this sequence version replaced XM_015244304.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Vicugna pacos Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6895
                     /organism="Vicugna pacos"
                     /mol_type="mRNA"
                     /isolate="Carlotta (AHFN-0088)"
                     /db_xref="taxon:30538"
                     /chromosome="14"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..6895
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 9 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 4 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102544967"
     CDS             335..4897
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_015099790.1"
                     /db_xref="GeneID:102544967"
                     /translation="
MERAGGEKSGSPEPSFLATLADPQVTLLSVHKRWSFRRSPGARGSIRPVTSEEEGCRPEEGGFSQKVLNGTQEIGSDQILSKLPWTARAWEPEMKQSFAFDNTGYEDGLDGMYPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVAEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMSLGLIDVRRLQSAHPKVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRHSPGPPQGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQRISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENCSSNHVGNYSAESSTGQAGPPRSVQEAAPRPGGLPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDCAGSDGDLELIITGMTCTSCVHNIESILTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFTDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQSEQTAHLNGVSSVPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPELEWYAAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYISQVSLSSLKSDKLSRHSTAASDRGDKWSLLLNDRDEEQCI"
     misc_feature    695..886
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(713..721,728..730)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    950..1138
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(968..976,983..985)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1301..1468
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1310..1318,1325..1327)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1589..1780
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1607..1615,1622..1624)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1973..2161
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1988..1996,2003..2005)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2198..2389
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2216..2224,2231..2233)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2453..4561
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3446..3448,3452..3454,4490..4492)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3578..3586,3788..3790,3941..3949,4037..4039,
                     4157..4165,4223..4225,4232..4234,4241..4243,4298..4300,
                     4307..4309)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     misc_feature    3578..3598
                     /gene="ATP7B"
                     /note="P-type ATPase signature motif; other site"
                     /db_xref="CDD:319783"
     misc_feature    3578..3580
                     /gene="ATP7B"
                     /note="phosphorylation site [posttranslational
                     modification]"
                     /db_xref="CDD:319783"
ORIGIN      
ggtggccgggcgtccaagcagttctgcgtgtgcgaggggctgtgtacagagattcctagggccaaataaatgcagtgtgatgagtaagaggatgccagttggtttgaggggtgtagataaacaagagcaaatatacatacagcagtgtgcagcctgccctggttcctggaagcctggctggcagcctccccgggctggctcaggggcagggcagcaggtgcctccccctcactagttaggaagacgcttttcaagcgttttcttctgacgtgaccaaatagcccgaagacgaactgctgttgcggcaggtggaggtgtcactgtggacttggcgatggagagagctgggggcgagaagtctgggagccctgagccgtccttcctggcgactctggctgacccacaggtgaccctgttgtctgtccacaaacggtggtccttcaggagaagccctggagcgagaggctccatcaggccagtgacttcggaggaggaaggctgtcgtcctgaggagggaggattttcacagaaggttttgaatggaacacaggagatcggttccgatcagatcctgtctaagcttccctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtacccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcatgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggccgtgaagtacgtgccgtcagtcctgagcctacctcaggtttgcagtcacatcgaggacatgggcttcgaagccagtgtggcggagggaaaggctgcctcctggccgtacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtctcgctcggcagccgggaggcggtcatcacttaccagccttaccttattcaaccacaagagctcagagaccatgtaaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgagcctgggactgatcgatgtcagacggctgcagagcgcccacccaaaggtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatggaatgcactgtaagtcttgcgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcacgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccactcccccgggcccccccagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagcggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagtgcagaagaactccgagctgccgtggaggacatgggatttgaggcatccgtcctggctgaaaactgttccagcaaccatgttgggaactacagtgctgagagttccacggggcaggctggcccccccaggtctgtgcaggaggcagctccccgccctgggggactccctgaaaaccacaaccccggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgcgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccgggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactgcgcgggctcggacggcgacctggagctgatcatcacagggatgacctgcacctcctgtgttcacaacatagagtccatactcacaaggacaaatggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgttcggcatccctgtcatgggtttaatgatctacatgttgatacccagcaatgagccgcacgagtctatggtcctggaccacaacatcatcccaggactgtccattctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcatcgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacactcctcccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacctcagaagcccttgccaaactcatgtctctgcaagccacagaagccaccgtcgtgactctcggtgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgtggcgataccatcaaggtcgtccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagttggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacatcggtggtatggattgtaatcggttttaccgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcgttccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacgctgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgcggaatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagagcgaacagaccgctcacctgaatggggtcagcagcgtccccgtggaaacagatgcggccccacagaccttctctgtgctgatcggaaaccgagagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacactgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagccagagccatcgccacccaggttggcatcaacaaagtcttcgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaacgaggggaagagggtcgccatggtgggcgacggggtcaacgactccccagccctggcccaggccgacgtgggcattgccatcgggacgggcacggatgtcgccatcgaagcggctgacgtcgtcctcatcagaaacgacctgctcgacgtggtggccagcattcacctctccaagaggactgtgtggagaatccgcctcaacctggtgctggcgttgatctacaacctggtcggaatacccatcgcagcaggtgtcttcatgcccatcggcatcgtgctgcagccatggatgggctcggcagctatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctataagaagccggagctggagtggtacgcagcacaggcacagggccgcatgaagcccctgactgcgtcccaggtcagcgtgcacatcggcatggacgaccggcggcgggactccccccgggccacaccctgggaccaggtcagctacatcagccaggtgtccctgtcctccctcaagtccgacaagctgtctcggcacagcactgcggccagtgacagaggggacaagtggtctctgctcctgaatgaccgggatgaggagcagtgcatctgaaagccacaggcaggcgcagaccccggccggcctggcccccctccccgtggccgaggctcgagcccagcaggcgtggcaccagcggccggcagcagggttgtggggcccctctccagccctggtgcttccgctccccgggcctccttgatcatcccgtcctgggcacgtggacggcgctgcctggccccacgggctcaggggaggcgtcctcccccgtgctgtggcggggcttgtcagaagcctgctgggacagccagccctctgctcagcctctgctttagcatttgggatgactgctcgtgacacgaggaagacctcatcaggaccaggaccttagccaggcctttccatggagctaataaaaacctcggggtcgggctcttttttgacgacacccacgtgcaacgtgtatctgagaccagtttacctcaagtgcacccattgtgctctgctggcaccgcctctcccttttctgcccttgacactgggggtgtggcaccccatcatccgaggccagggctgccgtcctcgcttccccgctgctgttctcgggtgcctctccgaggggctcgagtgctcctgcccgcgccccccaactcacacgcccgccggagagctcgccacacgtcctcagggcgagaagagttctttcttgctgctgagcctcttctctgtggagtcgtggcttctcactctgcagaaccgagtgctgttgctgattgtcgctgcccagctggagtgaggtctcagaacctgagacttgagaaatttgtcttcctgtgggatccaggtagacggaccccgggaggcctgtggtgcaggaacctgctggcccagttcctggggcttcagttacatggcctcacagggtccaatacagaattcatggaggtagtaccccaatgtgcagctccgaggaagtggtacccaaataagagagaggacaccccagtcctccacgtgctttgacttctgcacgctgagctggtgccttaggaaaggggtgaccacaacttcccaagggagagtctttctaacttgcagtggcctttgtggttgcatgacattggaggggcaggaacagggccattgtagactctgaggtcggtggtgattggcagaccacacaggggaagactagtatgatcagaatcttagaacaggcagagcagagcctgttcccagttctgagatgaagcctttgtcacacacacacagtcatttgagttatttattaagtgtcagctattttccagggggatacaaacactatttataaattacctctaatcctcccaacaaaccagcaaagtagataatgtccacgtttcacaggggggaacgggctcagagaggctagtgatcttgcccagaatcacacagccagtgtataggccagagcaggggtctgaatccacgtctattggctctgaagtcttttctccaactggcctctacttgaatagtttgcttgataagaatgaacaaggaaaaggcgcttgcacctggaagaagggatctgccaggtgatagattcatggacttggagtgaaattcaatcacaaggtcgtgtcaccttccctcgggatggttcctttccatttccatacagtttagtttttgctgggtcttactctctaaaaatccatgcacagcgctttgttgtgcttttactttccagtcctctctcccctcccagccccttcctgctctgtccccagtcttgtcctctctttactcttggctgtgctgggggtgtttcttgttttgtaactaggctggtcattgtctgaagaatctaattgtattgatttttcaaaaagcttttaggaccataaatgtcatgtttatggggacacaagaatatttatataattgtacggaaaataaccttttagatgttcaaagtataaggaatttttggtcagaaaagaattcctacttcagaaactttccatgctatattagaataaattttctttttttattcatctaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]