LOCUS       XM_014688570            1119 bp    mRNA    linear   PLN 26-JUN-2024
DEFINITION  Metarhizium brunneum Protein disulfide-isomerase erp38 (erp38),
            partial mRNA.
ACCESSION   XM_014688570
VERSION     XM_014688570.1
DBLINK      BioProject: PRJNA1128270
            BioSample: SAMN15394350
KEYWORDS    RefSeq.
SOURCE      Metarhizium brunneum
  ORGANISM  Metarhizium brunneum
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Hypocreales; Clavicipitaceae;
            Metarhizium.
REFERENCE   1  (bases 1 to 1119)
  AUTHORS   Saud,z., Kortsinoglou,A., Kouvelis,V.N. and Butt,T.M.
  TITLE     Telomere length de novo assembly of all 7 chromosomes of the
            fungus, Metarhizium brunneum, using a novel assembly pipeline
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1119)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (26-JUN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1119)
  AUTHORS   Saud,z., Kortsinoglou,A., Kouvelis,V.N. and Butt,T.M.
  TITLE     Direct Submission
  JOURNAL   Submitted (09-JUL-2020) Biocontrol and Natural Products Group
            (BANP), Biological Sciences, Swansea University, Singleton Park
            Campus, Swansea SA28PP, United Kingdom
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_089428).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1119
                     /organism="Metarhizium brunneum"
                     /mol_type="mRNA"
                     /strain="4556"
                     /host="Boophilus sp. [Acari: Ixodidae]"
                     /db_xref="taxon:500148"
                     /chromosome="7"
                     /geo_loc_name="USA: Florida"
                     /collection_date="29-Sep-1993"
     gene            <1..>1119
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /old_locus_tag="MBR_06173"
                     /db_xref="GeneID:26243443"
     CDS             1..1119
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /old_locus_tag="MBR_06173"
                     /codon_start=1
                     /product="Protein disulfide-isomerase erp38"
                     /protein_id="XP_014544056.1"
                     /db_xref="GeneID:26243443"
                     /db_xref="GO:0005783"
                     /db_xref="GO:0016853,GO"
                     /db_xref="GO:0045454,GO"
                     /db_xref="InterPro:IPR005788"
                     /db_xref="InterPro:IPR011679"
                     /db_xref="InterPro:IPR013766"
                     /db_xref="PFAM:PF00085"
                     /db_xref="PFAM:PF07749"
                     /db_xref="TIGRFAM:TIGR01126"
                     /translation="

MVLIKSLVLAAVAAVATARSAVMDLTPANFDKVVLKSGKPTLVEFFAPWCGHCKSLAPVYEELAVAFEHAKDKVQIAKVDADAERELGKRFGIQGFPTLKYFDGKSDKPEEYKSGRDLESLTEFLTEKAGVKAKKKLEMPSEVVMLTDKSFAETVGSEKNVLVAFTAPWCGHCKNLAPTWESLAADFVGEANVVIGKVDAEAPNSKAVATEQGVTSYPTIKWFQAGSKTGESYDGARSEDDFIKFINEKAGTHRVVGGGVDRVAGTIAVLDALVAKFTGGAKLEDIVGEVKSAVEKFNDDAKYAYAKYYVRVFDKLSKSDNYVSKELSRLEGILEKGGLAPSKRDEIQSKTNVLRRFAEKAAEKAEELKDEL"

     misc_feature    67..375
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /old_locus_tag="MBR_06173"
                     /note="PDIa family, endoplasmic reticulum protein 38
                     (ERp38) subfamily; composed of proteins similar to the
                     P5-like protein first isolated from alfalfa, which
                     contains two redox active TRX (a) domains at the
                     N-terminus, like human P5, and a C-terminal domain...;
                     Region: PDI_a_ERp38; cd02998"
                     /db_xref="CDD:239296"
     misc_feature    order(148..150,157..159,346..348)
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:239296"
     misc_feature    427..738
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /old_locus_tag="MBR_06173"
                     /note="PDIa family, endoplasmic reticulum protein 38
                     (ERp38) subfamily; composed of proteins similar to the
                     P5-like protein first isolated from alfalfa, which
                     contains two redox active TRX (a) domains at the
                     N-terminus, like human P5, and a C-terminal domain...;
                     Region: PDI_a_ERp38; cd02998"
                     /db_xref="CDD:239296"
     misc_feature    order(508..510,517..519,709..711)
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /note="catalytic residues [active]"
                     /db_xref="CDD:239296"
     misc_feature    793..1071
                     /gene="erp38"
                     /locus_tag="G6M90_00g107880"
                     /old_locus_tag="MBR_06173"
                     /note="Endoplasmic reticulum protein ERp29, C-terminal
                     domain; Region: ERp29; pfam07749"
                     /db_xref="CDD:462253"
ORIGIN      

atggtcctcatcaagagcctcgtgctcgccgccgtggccgccgttgcgaccgccagatccgccgtcatggatcttactcctgcaaacttcgacaaggtagtcctcaagtcgggaaagcctacacttgttgaattctttgccccctggtgcggccactgcaaaagcctggctcccgtgtacgaggagctcgccgtcgcctttgaacacgccaaggacaaggtacagattgccaaggtcgatgccgatgccgagcgggagttgggcaagcgttttggaatccagggattccctacgctcaagtactttgacggaaagtcagataagcccgaggagtacaagtctggccgagacctggagagcctgaccgagttcctgacggagaaggctggggtcaaggctaagaagaagctggagatgcctagcgaggttgtgatgcttactgataagagctttgcggagactgtcggaagtgaaaagaatgtgctggttgcgtttaccgctccttggtgcgggcactgcaagaacctggcacccacgtgggagagccttgctgccgatttcgtcggtgaggccaatgttgtcattggcaaggttgatgccgaagctcccaacagcaaagccgtggccaccgaacagggtgtcacttcttacccgaccatcaagtggttccaagctggaagcaagacgggcgagagctacgatggtgcccgctctgaggacgacttcatcaagttcatcaacgagaaggctggaacgcaccgcgttgtcggcggtggtgttgaccgtgttgctggaaccattgccgtccttgacgcgctggttgccaagttcaccggcggcgccaagttggaggatattgtcggcgaggttaagagtgccgtggagaagttcaacgacgatgccaagtatgcctacgccaagtactatgtccgtgtctttgacaagctgagcaagagcgataattatgtctccaaggagctctcaagactcgagggcatcttggagaagggtggcctggccccgtctaaacgtgacgagattcagagcaagaccaatgttctgcgccgcttcgctgagaaggctgctgagaaggccgaggagctcaaggacgagctgtaa

//