LOCUS       XM_013937559            1182 bp    mRNA    linear   INV 31-AUG-2017
DEFINITION  PREDICTED: Limulus polyphemus uncharacterized LOC106476945
            (LOC106476945), mRNA.
ACCESSION   XM_013937559
VERSION     XM_013937559.1
DBLINK      BioProject: PRJNA238073
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Limulus polyphemus (Atlantic horseshoe crab)
  ORGANISM  Limulus polyphemus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata;
            Merostomata; Xiphosura; Limulidae; Limulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_013677826.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Limulus polyphemus Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1182
                     /organism="Limulus polyphemus"
                     /mol_type="mRNA"
                     /db_xref="taxon:6850"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /country="USA: Woods Hole, MA"
                     /collection_date="Jan-2008"
     gene            1..1182
                     /gene="LOC106476945"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:106476945"
     CDS             1..1182
                     /gene="LOC106476945"
                     /codon_start=1
                     /product="uncharacterized protein LOC106476945"
                     /protein_id="XP_013793013.1"
                     /db_xref="GeneID:106476945"
                     /translation="

MVVDRVEERYIVVDRVEERTIVVDRVEERSIVVHRVEERTIVVDRVEERTIVVDRVEERTILVDRVEERTIVIDRVEKRIIVVKSVEERTIGVDRAEEHRVEERSILVDRVEERTIVVDRVEEHTIVVDRVEERTILVDRVEERTIVVDGIEERTIGVNRVEERTIGVNRVEERTIVVDRVEERIIVVKSVEERTIGVDRAEERSIVVDRVEERTIVIDRVEEHRVEERTIGVDRVEERTIGVDRVEERTIVVNRVEERTIMVDRVEERTIVIDRVEERSIMVDIVEERTIGVDRVEERTIVIDRVEERTIVVDRVEERTIGVDRVEERYIVVDRVEERTIVVDRVEERTIVVDRVEECTIVVDRVEERTIVVDRVEERTNLMVNRTQEPLVW"

     misc_feature    <319..>744
                     /gene="LOC106476945"
                     /note="Ring-infected erythrocyte surface antigen;
                     Provisional; Region: PTZ00341"
                     /db_xref="CDD:173534"
     misc_feature    <784..>1170
                     /gene="LOC106476945"
                     /note="Ring-infected erythrocyte surface antigen;
                     Provisional; Region: PTZ00341"
                     /db_xref="CDD:173534"
ORIGIN      

atggtggtagatagagtagaagaacgttatattgtggtagatagagtagaagaacgcactattgtggtagatagagtagaagaacgtagtattgttgtacatagagtagaagaacgtactattgtggtagatagagtagaagaacgtactattgtggtagatagagtagaagaacgtactattctggtagatagagtagaagaacgtactattgtgatagatagagtagaaaaacgtattattgtagtaaagagtgtagaagaacgtactattggtgtagatagagcagaagaacatagagtagaagaacgtagtattctggtagatagagtagaagaacgtactattgtggtagatagagtagaagaacatactattgttgtagatagagtagaagaacgtactattcttgtagatagagtagaagaacgtactattgtggtagatggaatagaagaacgtactattggtgtaaatagagtagaagaacgtactattggtgtaaatagagtagaagaacgtactattgtggtagatagagtagaagaacgtattattgtagtaaagagtgtagaagaacgtactattggtgtagatagagcagaagaacgtagtattgtggtagatagagtagaagaacgtactattgtgatagatagagtagaagaacatagagtagaagaacgtactattggtgtagatagagtagaagaacgtactattggtgtagatagagtagaagaacgtactattgtggtaaatagagtagaagaacgtactattatggtagatagagtagaagaacgtactattgtgatagatagagtagaagaacgtagtattatggtagatatagtagaagaacgtactattggtgtagatagagtagaagaacgtactattgtgatagatagagtagaagaacgtactattgtggtagatagagtagaagaacgtactattggtgtagatagagtagaagaacgttatattgtggtagatagagtagaagaacgtactattgttgtagatagagtagaagaacgtactattgtggtagatagagtagaagaatgtactattgtggtagatagagtagaagaacgtactattgtggtagatagagtagaagaacgtactaatcttatggtaaatagaacacaagaaccattggtatggtaa

//