2024-04-27 13:52:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013421956 861 bp mRNA linear PLN 05-JAN-2024 DEFINITION Rhinocladiella mackenziei CBS 650.93 uncharacterized protein (Z518_01356), partial mRNA. ACCESSION XM_013421956 VERSION XM_013421956.1 DBLINK BioProject: PRJNA292602 BioSample: SAMN02567657 KEYWORDS RefSeq. SOURCE Rhinocladiella mackenziei CBS 650.93 ORGANISM Rhinocladiella mackenziei CBS 650.93 Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Herpotrichiellaceae; Rhinocladiella. REFERENCE 1 (bases 1 to 861) AUTHORS Cuomo,C., de Hoog,S., Gorbushina,A., Stielow,B., Teixiera,M., Abouelleil,A., Chapman,S.B., Priest,M., Young,S.K., Wortman,J., Nusbaum,C. and Birren,B. CONSRTM The Broad Institute Genomics Platform TITLE The Genome Sequence of Rhinocladiella mackenzie CBS 650.93 JOURNAL Unpublished REFERENCE 2 (bases 1 to 861) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (29-DEC-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 861) AUTHORS Cuomo,C., de Hoog,S., Gorbushina,A., Stielow,B., Teixiera,M., Abouelleil,A., Chapman,S.B., Priest,M., Young,S.K., Wortman,J., Nusbaum,C. and Birren,B. CONSRTM The Broad Institute Genomics Platform TITLE Direct Submission JOURNAL Submitted (30-JAN-2015) Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02142, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_013550604). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..861 /organism="Rhinocladiella mackenziei CBS 650.93" /mol_type="mRNA" /strain="CBS 650.93" /isolation_source="phaeohyphomycosis of the brain" /host="Homo sapiens" /culture_collection="CBS:650.93" /type_material="culture from type material of Ramichloridium mackenziei" /db_xref="taxon:1442369" /chromosome="Unknown" /country="Saudi Arabia" /collection_date="1993" gene <1..>861 /locus_tag="Z518_01356" /db_xref="GeneID:25289427" CDS 1..861 /locus_tag="Z518_01356" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_013277410.1" /db_xref="GeneID:25289427" /translation="
MTSVSNAIRPLLRFRISSVCIPRRYATSSSSSTAGSSKRASQVLPSKSKPSPTRLESPAGPGHNDLEPEQLKKQWYATKLYQAGQRVIFRPKSHTGILAASYVIAGSCLVTSCGLAFNNIWAYQTNADLHWIVGVAWRLGIITFTVIGGLAFLRPTGMIKSIDLVSRDGVVKLLVEARPTLPFLRPKSYTIAPYQFEMDRTFVQQLDEPEFMYEDAPQPQGIAASIGRTISKAIWYPFAATRRLVTNEGFMHVQLATKDAPWLKLDTQGTFSNDGRDLLAMGTLKL"
ORIGIN
atgacttcggtctctaacgccattcggcctctacttcgattccgaatctcgtcagtgtgcattccacgtcgctacgctacctcatcttcttcttctaccgcaggcagttcaaaacgtgcttcacaggttctcccatcgaagtcgaagccttccccaacgcgactcgagagtccagctggaccaggtcacaatgacctcgaaccggagcagctgaaaaagcagtggtatgccaccaaattataccaggccggccagcgagtcatattcagaccaaaatcgcataccgggatattggcggcctcatatgttatcgccgggtcttgcctcgtcaccagctgcgggctggctttcaacaacatttgggcatatcagacaaatgcagacctccactggatagtgggagttgcatggcgactggggatcattacattcacagtcattggcggacttgcttttttacggccaacgggaatgatcaaatcaatcgacttggtctcaagagacggcgtggtgaagcttctggtggaggcgcgaccgacgctgcccttcctgcgaccaaagtcatacactattgctccttatcaatttgagatggatcggacttttgtacaacagctggatgagccagagttcatgtatgaggatgcgccgcagccgcaaggaatcgcagcaagcatcggtcggacgatcagcaaagcgatatggtacccttttgccgccacacggaggctggtaaccaacgaaggattcatgcatgtgcaacttgccaccaaggatgccccctggctcaagctggacacacaaggcacattttctaatgacgggagggacctgctcgcaatgggcaccctcaaactttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]