GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 16:14:20, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_013382114             498 bp    mRNA    linear   PLN 28-DEC-2023
DEFINITION  Mitosporidium daphniae mitochondrial distribution and morphology
            protein 34 (DI09_43p160), partial mRNA.
ACCESSION   XM_013382114
VERSION     XM_013382114.1
DBLINK      BioProject: PRJNA292596
            BioSample: SAMN02714227
KEYWORDS    RefSeq.
SOURCE      Mitosporidium daphniae
  ORGANISM  Mitosporidium daphniae
            Eukaryota; Fungi; Fungi incertae sedis; Microsporidia;
            Mitosporidium.
REFERENCE   1  (bases 1 to 498)
  AUTHORS   Haag,K.L., James,T.Y., Pombert,J.F., Larsson,R., Schaer,T.M.,
            Refardt,D. and Ebert,D.
  TITLE     Evolution of a morphological novelty occurred before genome
            compaction in a lineage of extreme parasites
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 111 (43), 15480-15485 (2014)
   PUBMED   25313038
REFERENCE   2  (bases 1 to 498)
  AUTHORS   Haag,K.L., James,T.Y., Larsson,R., Schaer,T.M., Refardt,D.,
            Pombert,J.-F. and Ebert,D.
  TITLE     A new species of microsporidia sheds light on the evolution of
            extreme parasitism
  JOURNAL   Unpublished
REFERENCE   3  (bases 1 to 498)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (28-DEC-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   4  (bases 1 to 498)
  AUTHORS   Haag,K.L., James,T.Y., Larsson,R., Schaer,T.M., Refardt,D.,
            Pombert,J.-F. and Ebert,D.
  TITLE     Direct Submission
  JOURNAL   Submitted (24-APR-2014) Biology, Illinois Institute of Technology,
            3105 South Dearborn, Chicago, IL 60616, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_013546356).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..498
                     /organism="Mitosporidium daphniae"
                     /mol_type="mRNA"
                     /strain="UGP3"
                     /host="Daphnia magna"
                     /type_material="reference material of Mitosporidium
                     daphniae"
                     /db_xref="taxon:1485682"
                     /chromosome="Unknown"
                     /tissue_type="spores"
                     /country="United Kingdom: Kaimes"
     gene            <1..>498
                     /locus_tag="DI09_43p160"
                     /db_xref="GeneID:25259970"
     CDS             1..498
                     /locus_tag="DI09_43p160"
                     /codon_start=1
                     /product="mitochondrial distribution and morphology
                     protein 34"
                     /protein_id="XP_013237568.1"
                     /db_xref="GeneID:25259970"
                     /translation="
MLSAGDKGSVFWPGEVSILEIAELSMHRARILARISYASDGYIVINTHVQANPLCGTRGASYEDWMSSVKMDTPPQPILAADKSLVVPMVIRITDLHVDGIIWLCWTDQSPHFSLAFVSDPLVNVSVSSSFDCMAKVKQSLQEEIEQEIRKALLKTIPEAARSYR"
     misc_feature    <22..477
                     /locus_tag="DI09_43p160"
                     /note="synaptotagmin-like mitochondrial-lipid-binding
                     protein (SMP) domain superfamily; Region: SMP_SF; cl45903"
                     /db_xref="CDD:459248"
ORIGIN      
atgctctcagctggtgataaaggatctgtattttggccaggagaagttagcattttggaaatcgcggaactttctatgcacagagctagaattttagcccgaatatcatatgcctcagatggatatattgtcatcaacacacatgtgcaggcgaatccgctttgtggtacacgaggggcctcatatgaggattggatgtcttcggtcaagatggacacgccgccccagccgatccttgctgcggacaagagcctggtcgttccaatggttatcagaataactgacctccacgtggatggcatcatatggctttgctggaccgatcaatctccgcatttctctctagcatttgtgtccgacccgctcgttaatgtttccgtgtcttcttctttcgattgcatggcaaaggtaaagcaatctctccaagaagagattgaacaggaaattagaaaagcactattgaagacgattccagaggcagctcggtcctaccgatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]