GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:39:28, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_013006878            4467 bp    mRNA    linear   MAM 19-SEP-2019
DEFINITION  PREDICTED: Echinops telfairi ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_013006878
VERSION     XM_013006878.1
DBLINK      BioProject: PRJNA193504
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Echinops telfairi (small Madagascar hedgehog)
  ORGANISM  Echinops telfairi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Afrotheria; Tenrecidae; Tenrecinae; Echinops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022103908.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Echinops telfairi Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 3% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..4467
                     /organism="Echinops telfairi"
                     /mol_type="mRNA"
                     /isolate="266"
                     /db_xref="taxon:9371"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="Germany: Ludwig Maximilians University, Munich"
     gene            1..4467
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 17 Proteins"
                     /db_xref="GeneID:101658383"
     CDS             1..4467
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_012862332.1"
                     /db_xref="GeneID:101658383"
                     /translation="
MEKDRSQGSEQSALATLSDPQVTLLAAHKRRSSRSPGARGSTLPEDSSPSRKGERSQRGLTGTREIRPNQISSQPSVPARAWEPAMKQDFAYDNAGYESSENSVATSTVHIVGMTCQSCVKTIESMVSSMDGIVSVKVSLEQGNAAVRYMPSAVSLQQVCYLIEDIGFEASVTGGKAAPRPSPVGEALVKLRVEGMTCQSCVNSIEGKLGKLQGVVRAKVSLGNQEAVIAYQPYLIQPEDLRDHVSDMGFEATIKHKAAPLSLGPIDIGRLQSTNPKRLSTPVPQSPRGPEPPGDQGSPGVTLQLRVEGMRCKSCVFNIENNIGRLPGVHEIQVSLEHGTAQVHLEPSLISPETLQEAIEALPPGNFQVSLPGASEGNGTERRASGCSQRSEEPGAHSRVTLAIAGMKGASCVQSIKGVLSQREGVRRVSVSLAEGTGSILFHPALLNPEELRAAVQNMGFEVTILSDNSSSNHTGSLGAGNAAVQTPGGTPMSTQAPPDRRSPRSPHPGHSSRSPPSPEVAPQKCFLQITGMTCASCVSNIERSLQKEAVGKRITVPQEFGGGGLKSCGERLVAAFPQNSPRCLGSGPVPAPWVGCLSSVLQIRGMTCASCVHNIESKLTRTHGITYASVALATSKAHVKFDPEIIGPRDIVKIIKETGFHASLAQRDPNAHHLDHRLEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSQEPHEAMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLKHGAANMDVLIVLATSIAYAYSLVILVVAIAERAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNVIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSLNAHGSVLVTATHVGRDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIVISTLTLVVWIIIGFIDFGVVQKHFPGHSKHISQTEVILRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLELAHKIKTVMFDKTGTITHGVPKVTRFLLLVDVAALPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTEALGYCTDFQTVPGCGIGCKVSNVGGTLAPKEHLNGVSNGPAEKDAAPETFSVLIGNREWMRRNGLSISSDVSAAMTDHEMKGQTAVLVAIDGVLCGMIAIADSVKQEAVLAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQLQGKRVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRTNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYRKPDLEWYEVQAHGRLKPLTPSQVSVHIGLDDRLRDAPRPSLWDQVSYVSQVSLTSDRLSRHSAAADDGGDKWSLLLTDRDEEEYI"
     misc_feature    331..513
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(340..348,355..357)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    568..759
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(586..594,601..603)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    910..1086
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(928..936,943..945)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1201..1392
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1219..1227,1234..1236)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1801..1992
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    1804..4143
                     /gene="ATP7B"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
     misc_feature    order(1819..1827,1834..1836)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2407..3150
                     /gene="ATP7B"
                     /note="E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122"
                     /db_xref="CDD:278548"
     misc_feature    3646..4005
                     /gene="ATP7B"
                     /note="Soluble P-type ATPase [General function prediction
                     only]; Region: COG4087"
                     /db_xref="CDD:226572"
ORIGIN      
atggaaaaagacaggagccagggctctgagcagtcggccctggccacgctgagcgacccgcaggtgaccctgctggcggcccacaagcggaggtcctccaggagccctggggccagaggctcgacccttccagaagactcttccccctccaggaagggagagcgttcccagaggggcttgactggaacccgggaaatccgccccaatcagatctcgtctcaaccctctgtgcccgctcgtgcctgggaaccggccatgaagcaggatttcgcctatgataatgcgggctacgaaagcagtgagaacagtgtggccaccagtacggtccacattgtgggcatgacatgccagtcttgtgtcaagaccatcgagagcatggtgtccagcatggatggcatcgtgagcgttaaggtctccctggagcagggcaacgccgccgtgcggtacatgccgtccgccgtgagcctgcagcaggtctgctacctcatcgaggacataggcttcgaagccagtgtcaccggagggaaggctgcccccaggccctcccccgtgggggaggccctggtcaagcttcgagtggaaggcatgacctgccagtcctgcgtcaactctatcgagggcaagctagggaagctgcagggtgtggtgcgcgccaaagtctccctgggcaaccaggaggccgtcatcgcctatcagccttaccttattcaaccagaggacctcagggaccacgtcagcgacatgggattcgaagctaccatcaagcacaaggcagcccccctgagcctggggccaatcgatatcggacgcttgcaaagcacgaacccaaaaaggctctcaactcctgttcctcagagtccccgtggtcctgagcccccgggggaccaaggaagccccggcgtcaccctgcagctgagggtagagggaatgcggtgtaagtcttgtgtcttcaacattgaaaacaacatcggccggctccccggggtccacgagatccaagtgtccttggagcatggaacagctcaagtacaccttgagccttctctcatctcccctgagaccctccaggaggccattgaagctcttcccccggggaacttccaagtttctcttcctggggcctcagaagggaatgggactgagcgccgggcctctggctgctcccagcggagtgaggagcctggagcgcacagcagggtgacgcttgccattgcaggcatgaagggcgcatcctgcgtccagtcgatcaaaggagtcctctcccagagggaaggtgtgcggcgggtgtctgtctccctggcagaagggaccggcagcatcctctttcaccctgctctgctgaacccagaagagctcagagctgctgtccaaaacatgggattcgaggtgaccatcctctccgacaactcttccagcaaccatactggaagcctgggtgctgggaatgctgcggtacaaacgccaggtggcaccccgatgtccacacaggcgccccctgacaggaggtcccctcggagcccccaccccggccactcgtctcgctccccaccatctccagaggtggctccgcagaaatgctttttacagatcacgggcatgacttgtgcctcctgtgtgtccaacatagagcggagcctgcagaaagaagccgtggggaagcgcatcactgtgccccaggagtttggaggtgggggcctaaagtcttgtggggaaaggcttgtggctgcctttccccagaactccccaaggtgccttgggtcgggccctgtccccgctccgtgggtgggatgtctgtcatctgtgttacagatccgagggatgacctgcgcctcctgtgttcacaacatcgagtccaagctcacgaggacacacggcatcacctacgcctctgtggccctcgccaccagcaaagcccatgtgaagtttgaccccgaaatcatcggtccacgggatattgtgaaaatcatcaaggaaactggctttcatgcttccttggcccagagagaccccaacgctcatcacctggaccacagactggaaataaagcagtggaagaagtctttcctgtgcagcctggtgttcggcatccctgtgatgggtctgatgatctacatgctaatccccagccaagagccccatgaggctatggtcctggaccacaacatcatccccggactgtccattctaaacctcatcttcttcatcctgtgtacctttgttcagttcctcggcgggtggtatttctacgtccaggcctacaagtctctgaagcacggggcggccaacatggacgtgctcatcgtgctggccacgagcatcgcctacgcctactccctggtgatcctggtggtggccatcgcggagagggccgagaggagcccggtgaccttcttcgacacgccgcccatgctctttgtgttcattgccctggggcggtggctggagcacgtggccaagagcaaaacctcagaagccctggccaagctcatgtctctccaagccacggaggccaccgtcgtgaccctgggggaggacaacgtcatcatcagagaggagcaggtgcccatggagctggtgcagcggggtgacatcatcaaggtggtccctggagggaagttcccagtggacgggaaggtcctggaaggtaacaccatggccgacgagtccctcatcacaggagaagccatgccggtcaccaagaagccaggcagcacggtgatcgcaggctccctcaacgcccacggctctgtgctcgtgactgccacccacgtgggccgagacaccaccctggcccagattgtgaagctggtcgaagaggcccagatgtcaaaggcacccattcagcagctggctgaccggttcagtgggtattttgtccccttcatcatcgtcatttcgacgttgacgttggtcgtatggattatcatcggttttattgattttggtgttgttcagaaacacttccctggccacagcaagcacatctcgcagacagaggtgatcctgcggtttgccttccagacgtccatcaccgtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggggtggctgcgcagaacggcatcctcatcaaggggggcaagcccctggagctggcacacaagataaagaccgtgatgtttgacaagacgggcaccatcacccacggggtccccaaagtcacacgcttcctcctgctggtggatgtggccgcgctccctctcaggaaggtccttgctgtggtggggaccgccgaggccagcagtgagcaccccttgggcgtggcggtcaccaagtactgtaaagaggaacttggaacagaagccctgggctactgcacggacttccagacagtcccgggctgtggcatcggctgtaaggtcagcaacgtgggcggcaccctggccccgaaggagcacctgaacggagtgagcaacgggcccgccgagaaagacgcggcccccgagaccttctccgtgctgatcgggaaccgcgagtggatgaggcgcaatggcttgtccatctccagcgacgtcagtgccgcgatgacagaccacgagatgaaagggcagacggccgtcctggtggccatcgatggtgtcctctgcggcatgatcgccatcgcggactctgtcaagcaggaggccgtgctggctgtgcacacgctgaagagcatgggggtggacgtggttctgatcaccggggacaaccgcaagacggcccgggccatcgccacgcaggtcggcatcaacaaggtctttgccgaagtgctgccctcccacaaggtggccaaggtccaggagctgcagctccaagggaagagggttgccatggtcggagacggggtcaatgactccccggctttggcccgggccgacgtgggcattgctatcgggacgggcacggacgtggccatcgaggcggccgacgtggttctcatcaggaatgacctcctcgacgtggtggccagcatccacctttccaagaggaccgtgcggagaatacggaccaacttggtcctggcgttgatctacaacctgattgggatacccattgcggcaggtgtcttcatgcccatcggcatcgtgctgcagccctggatggggtcggcggccatggcggcctcctcggtctccgtggtgctatcgtccctgcagctcaagtgctacaggaagccagacttggagtggtacgaggtgcaggcccatggccgcctgaagcccctgaccccatcccaggtcagcgtgcacatcggtttggatgaccgcctgcgggacgccccccggccctcgctgtgggaccaggtcagctacgtcagccaggtgtctcttacctcagacaggctgtcccggcacagtgccgcagccgacgacggcggggacaagtggtccctgcttctaacggacagggatgaggaggagtacatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]