GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:02:58, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_013003682            3039 bp    mRNA    linear   MAM 19-SEP-2019
DEFINITION  PREDICTED: Echinops telfairi NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), mRNA.
ACCESSION   XM_013003682
VERSION     XM_013003682.1
DBLINK      BioProject: PRJNA193504
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Echinops telfairi (small Madagascar hedgehog)
  ORGANISM  Echinops telfairi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Afrotheria; Tenrecidae; Tenrecinae; Echinops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022103915.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Echinops telfairi Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 6% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..3039
                     /organism="Echinops telfairi"
                     /mol_type="mRNA"
                     /isolate="266"
                     /db_xref="taxon:9371"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="Germany: Ludwig Maximilians University, Munich"
     gene            1..3039
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 9 Proteins"
                     /db_xref="GeneID:101644735"
     CDS             1..3039
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog"
                     /protein_id="XP_012859136.1"
                     /db_xref="GeneID:101644735"
                     /translation="
MALFPAFADVGEVADSRNPRKVADLDWLHNPSFCVGAVAAPCEQPEEVHRLTSEPSPPTRSPLKSEPSDESAVGPQLKEASRKKKREKKRKRRQEHKRTERRRGRPSSSSSGSGSSSGSEPDTDADRGRSSRSVRKKDSGKPGQESPADTRCQFVWLEDVQALSGETFRMDKKPDPANWEYKCPYRGHIARYKRKGDSCLGLDPRRQRVSWEGAPAGQKRAHRRMERYFTKRSTGLLSLDSVAVSAQAEPPTTEPLGFIPVKDIGEAAPPVTTWLNPLGVYDPSTTQWLQGQGPVEQEPKPSGVQADPASALLKAKVEEFNRKVRENPRDIQLWLAFVAFQGWRAHVALTGGPAGQCQVGGHSATPMGIAAPSSLLCPLPREVGWVAAGLLAEQVKQEFCCRPDEEDEEPDEDEQEIGDRTLPRAQIWLRAERSRDRRHWRPWRPDRTKKQTEEDCEDPERQVLFDDIGQCLIRLASPELRFQLVAAFLQFLGVPCDFTPPASCLYMALDESSIFTGGLGGEKPLSRASPTFSGVSRVGRMDQFGVPCGAPGHDREGEEFIRNIFHLALPLFSGKDKARLCAAWLQHETAKVVWCLHTKAKKKLRSQGKNCRKLAKNLLREPESSSSVGLWRHYAHLEWLLGNTEDARKVFDTALSMVGAGGLRDAQLCELSLLYAQLEVELLPAAQEATASRAVHVLTGLAESTPYKPYPGHVLPVHILKARKAYEHALQDALEESCGSEPGPACRPSRLVSLAKCFMLFQYLTVGIEAAGCVHEQVWAQLKGSAVSEGSGAGSAGQPQKWAGELEAVTLLHTSLLQFHLRVSVHPLAPLREALTESLRLYPGNQALWRAYVQTQSRSHSASKTRRFFDAITRSTESLEPWLFAIETEKARKKRVETVQRVDGGEIHTTIPEIGLTNRIQALFEHAIQTDRGRQCPLLWRMYLHFLVSLGNRERSKGVFYKALQNCPWAKVLYMDALEYFPDEMQEILDLMTEKELRVRLPLEELELLLED"
     misc_feature    <1246..1479
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
     misc_feature    <1885..>2016
                     /gene="NRDE2"
                     /note="P-loop containing Nucleoside Triphosphate
                     Hydrolases; Region: P-loop_NTPase; cl21455"
                     /db_xref="CDD:304359"
ORIGIN      
atggcgctgttcccagcctttgccgacgttggtgaggtcgccgacagcaggaacccccggaaagttgctgacttagactggctacacaaccccagcttctgcgtgggagctgtagcagcgccgtgtgaacagcccgaggaggtccaccgcctcacctcggagccatcaccaccaaccaggagtcctttgaagtcagagccttctgatgaaagtgccgtcggcccacagctcaaagaagcaagccgaaagaagaagagagagaagaagaggaagaggagacaggaacacaagagaactgagcggagacgtgggcggcccagcagcagcagcagcggcagcggcagcagcagtgggtctgagccggacaccgatgccgacagggggaggtcttccagaagcgtccgcaaaaaggactctgggaagccaggacaggagagtcccgccgacaccagatgtcagtttgtttggctcgaagacgtgcaggcgctgtcgggggaaaccttcaggatggacaagaagccagaccctgccaactgggagtacaagtgtccctaccgtgggcacatcgcgaggtacaagaggaaaggcgactcctgcctgggcctagatccccggaggcagcgtgtgtcttgggaaggggctccggcggggcagaagcgcgcccacaggcgcatggagcgctacttcacgaagagaagtaccgggctgctgagcttggacagcgtggctgtcagtgcccaggccgagccgcccaccaccgagcccctgggcttcatacctgtgaaggacattggtgaggcggcccctccggtcacaacctggctgaaccctctgggggtctacgacccttccaccacgcagtggctccaagggcagggccccgtggagcaggagccaaagccttcaggcgtccaggctgaccccgccagcgcccttctcaaggccaaggtggaggagttcaacaggaaggtgcgggagaatcctcgggacattcagctgtggctggcgtttgtggccttccagggctggagggcacatgtggccctcacaggaggccctgctgggcagtgccaggtgggcgggcactctgccacgcccatgggcattgctgcaccctcgtcgctcctctgccccctgccccgggaggtgggttgggtggcagcagggctgctggctgagcaggtgaagcaggagttttgttgtcgtccagatgaggaggatgaggagccggatgaggacgagcaggagataggagacaggaccctgcctcgggctcagatctggctgcgtgcagagcgctcccgagaccgccgccactggcgcccctggcgccccgacaggaccaagaagcagaccgaggaggactgcgaggaccccgagaggcaggtgctgttcgatgacatcggccagtgtctgatcagactcgccagcccagagctccggttccagctggtggcggccttcctgcagttcctgggtgtgccctgtgacttcaccccgccggcctcctgcctctacatggccttggacgagagcagcatcttcactgggggcctcggtggcgagaagcccttgagcagggccagtcccaccttctccggcgtgagccgtgtgggccgcatggaccagtttggtgttccgtgcggggccccgggccatgaccgggaaggtgaggagttcatccgaaacatcttccacctggcgctgccgctgttctccggcaaggacaaggcccgcctctgcgccgcctggctgcagcacgagactgcaaaggtcgtgtggtgtctgcatacgaaagccaagaagaaactgcggtcccaggggaagaactgcaggaagctggccaagaacctcctcagggagcccgagagcagcagcagcgtgggcctctggcggcactacgcccacctggagtggctgctgggcaacacagaggacgccaggaaggtctttgacacggcgctcagcatggtgggagctggaggcctgcgggacgcgcagctctgcgagctcagcctgctctacgcgcagcttgaggtggagctgctgccagccgcgcaggaggccacggcgtccagggcggtccacgtgctgacggggctggccgagagcaccccgtacaagccctaccccgggcacgtcttgcccgtgcacattctgaaggcccggaaggcctatgagcatgcgctgcaggacgccttggaggagagctgcggctcagagccaggtcccgcctgccgccccagccgcctggtcagcttggccaagtgcttcatgctcttccagtacttgaccgtgggcattgaggctgcggggtgcgttcatgagcaggtgtgggcgcagctgaagggctcggcagtgtctgaaggctctggagcggggtccgccgggcagccgcagaagtgggcaggcgagctggaagccgtcacactgctgcacacgagcctgctgcagttccacctgagggtcagcgtgcacccgctggccccgctgcgggaggcgctcactgagtcactgaggctgtacccgggcaatcaggccctgtggagggcgtacgtccagacgcagagcaggtctcacagtgccagcaagaccaggaggttctttgatgccatcactaggtccactgaatccctggagccttggctgtttgcgatcgagacagagaaagcgaggaagaaacgggtggagaccgttcagagggtggatggtggagaaatacataccacgatccccgagattggcttaaccaaccgcatccaggccctattcgagcacgcgatccagactgaccggggcagacagtgccccctgctgtggaggatgtacttgcattttttggtttccctgggaaatagagagagaagcaaaggtgtgttctacaaagcactccagaactgcccctgggcaaaggtgctgtacatggatgccctagagtacttcccggatgagatgcaagagatcctggacctgatgactgagaaggagctgcgggtgcgcctgcccctggaggagctggagctcctgctggaagactag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]