GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:20:51, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_012819771            5096 bp    mRNA    linear   VRT 18-NOV-2019
DEFINITION  PREDICTED: Clupea harengus ATPase copper transporting beta (atp7b),
            mRNA.
ACCESSION   XM_012819771
VERSION     XM_012819771.2
DBLINK      BioProject: PRJNA587748
KEYWORDS    RefSeq.
SOURCE      Clupea harengus (Atlantic herring)
  ORGANISM  Clupea harengus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Clupei; Clupeiformes;
            Clupeoidei; Clupeidae; Clupea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045172.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 18, 2019 this sequence version replaced XM_012819771.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Clupea harengus Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5096
                     /organism="Clupea harengus"
                     /mol_type="mRNA"
                     /db_xref="taxon:7950"
                     /chromosome="21"
     gene            1..5096
                     /gene="atp7b"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 14 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:105893361"
     CDS             411..4706
                     /gene="atp7b"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_012675225.2"
                     /db_xref="GeneID:105893361"
                     /translation="
MKKFTSNVKSLNSLTRHASNSAVEQVCMVDCPQIIKPISLTPVFGEHVLGPDGVLHKDGQEAVKPKQENGGVSDAWPPPKLGFDNLGFVPGSPCEMCPQARGLCCGARDSAVGRDTQVLTPPVKSALVRIRVEGMTCQSCVQSIEGRIGELPGVMAIQVYLSDKEASVTFNPGQVGPEELRTHIEDMGFDAILTSSPIPTSSHGRKLEVNAAAGEVAMTLGVEGMHCGSCVHNIQEHVSGLLGVCSVSVSLETRHMDLKYDPSLVTLEMVKGLVEGIPPGNFHVTLPTLPVETPAGIWTTSSMEMTPSSQHLNSASTSQTSDSVPFPAATIGILGMTCNSCVQSIEGMISQRPGVQSIRVSLKKEKGMVIFNPTLTSAEELREAIEDMGFEATLEKEPSSTDKGTTSEPKGKTSPYHRPQPSNDLAAKVPRDQQSGEGTTQRCFIRVTGMTCASCVANIERSLLKHKGVVSVLVSLMAGKADVRYDPKVLDAVEVTGLISSLGFGAALIETNAVIDGKLDLSVTGMTCASCIHNIENKLLGTKGVFEVSVSLATTKAHVKFDPEILGARDIIRSIEALGFGASLIKSDGCGKNEALDHREEIQQWKQSFLFSLVFGVPVMGLMIYMMVMDSQHQEHGGSMPHEQNVFPGLSILNLAFFLLCTPVQIFGGRYFYIQAYRSLKHKVANMDVLIVLATTISYIYSCVVLLVAIAEKAEQSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLMSLQATDATIVTLGPDNSILREEQVSVDLVQRGDVVKVAPGGKFPVDGKVIEGSSMADESLITGEPMPVSKKPGSYVIAGSINGHGALLVEATHVGADTTLSQIVKLVEEAQTSKAPIQQFADKLSGYFVPFIILVSVVTLVVWLIIGFLDFDIVAEYFPGYDKNIPHTDVIVRFAFQTSLTVLSIACPCALGLATPTAVMVGTGVGAQNGILIKGGEPLEMAHKIKAVMFDKTGTITNGVPKVTRVLVLWDQARMPLRKVLAVVGTAEASSEHPLGMAVTKHCKQELDTKTLGFCHDFQAVPGCGISCRVSNIDELLRNLDQTAISLETHLTIQGATTDESILLNGSEPACNPGTYSVLIGNREWMRRNGLHITTDVDEAMTSHETKGQTAILVAIDGVLCAMLAIADTVKPESALAVHTLRSMGIDVVMITGDNRRTAKAIATQVGIRKVFAEVLPSHKVAKVQELQEQGLRVAMVGDGVNDSPALARADLGIAIGTGTDVAIEAADVVLIRNDLLDVVASIELSKKTVQRIRINFVFALIYNLLGIPIAAGVFMPAGLVLQPWMGSAAMAASSVSVVVSSLLLRLYKKTPVELYELRAQGHMKSLNPSQVSIHVGLDDRQRTPPSGRHTWDRQSQGGYIPESLRPPSQAAEAPSSSIALDRRSLLDDEGEVDLIV"
ORIGIN      
ttgcttacagcaatacaacacattaaagtccgtgtaaggaacaatggacattcgcagccgattggatgcctttttgaagctgtaggctattctggttgacaaaaataatactgccattccccattacaaaatcaaaaaggttactgtgatgaacacgccccatatcgaagtatggataggtctgcttggatttcacaaggctgaatccgagtgcagcgcacgagccatttagtcacaggaaccggtatttggtgtactagtaagtcccgatgtctggttcaggtgtcacggatttgtaaacggcggtgacagaaagggaaaaactattgaacatgttctttcggtcagcgaatacagaaaatatgttatagcatgtcttgtaactgagaattgccagtcagttcgttaaaatgaaaaagtttacatccaatgttaagtcactgaacagtttgaccaggcatgcttcaaacagtgccgtggagcaggtttgcatggtagactgtccccagattattaaaccgatcagtttgacacctgtttttggagaacatgttttgggacctgatggagtgctacacaaagatgggcaggaagccgttaagcctaaacaggagaatggtggtgtcagtgatgcctggccccctccaaaacttggctttgataacttgggctttgtcccggggagtccttgtgagatgtgcccccaagccagagggttgtgctgtggggccagggactctgctgtggggagagacacacaggttctgacacctcctgttaaatctgccctggtgaggatcagggtggagggtatgacgtgccagtcgtgtgtgcagtccatcgaggggcgcataggagaactgcccggtgtcatggccattcaggtgtacctaagtgacaaggaagcctcagtgacctttaaccctgggcaggtgggtccagaggaactgaggacccacattgaggacatggggtttgacgccattctcacaagcagccccattccaacctcctcccatggaaggaagctagaagtgaatgcagcggcaggggaggtggctatgaccctgggtgttgaagggatgcattgtgggtcttgtgtgcataacatccaagagcatgtgtcaggacttttgggggtctgttctgtaagcgtctccttagaaacaaggcatatggacctgaagtatgacccctctctggtcaccttggagatggtgaaggggctcgtggaggggatcccacctggtaattttcatgtgaccttgccgaccttgccagtggaaactccagctgggatctggaccacaagttccatggagatgacccccagctcccaacacctgaactctgcatccacgtcccaaacttcagacagtgttccttttccggctgctaccattggaatcttagggatgacctgcaactcttgtgtgcagtccattgaagggatgatatcccagaggcctggggttcagtccatcagggtctcattaaagaaggaaaagggaatggtgatctttaatcccacactgaccagtgcagaggagctgagggaagccattgaggatatggggtttgaggctacactggagaaagagcccagctccacagacaaagggacaacctctgaacccaaaggcaaaacctctccttaccatcgtccccagccatctaatgacctagcagctaaagtacccagagaccagcagtctggggaagggaccacccagaggtgctttattcgtgtgactggcatgacctgtgcctcctgtgtggccaacattgagcgcagcctcctcaaacacaagggtgtggtgtctgttctggtatccctgatggcagggaaggcagatgtccggtatgacccaaaggtgctggatgcagttgaagtcaccggactcatatccagtcttggcttcggtgccgcactcatagagaccaatgcagttattgacgggaaactggatctctctgtgactggcatgacctgtgcatcatgcatccataacattgaaaacaaactgctcgggactaagggggtttttgaggtctctgtctcactggcaaccacaaaggctcatgtgaagtttgacccagaaatacttggtgccagggacatcatcagaagcattgaggctttgggctttggagcgtctctgatcaaaagtgacggctgtgggaaaaatgaagcattggaccaccgggaggagattcagcaatggaagcagtccttcctgttcagcctggtgtttggggttcctgtgatgggtctgatgatctatatgatggtgatggacagtcagcaccaggagcacggcggctccatgccccacgagcagaacgtctttcctggactctctatccttaacctcgccttcttccttctctgcacacctgtgcagatctttggggggcgatatttctacattcaggcataccgctcgctgaaacacaaagtggctaatatggacgtcctgatcgtattggccaccaccatctcgtacatctactcctgcgttgtcctattggttgctatcgcagagaaggcggagcaaagcccggtcaccttcttcgacactccccccatgctgttcgtcttcattgctcttgggcgatggctggaacacattgccaagagtaagacgtccgaggctctggccaaactcatgtccctgcaagcgactgatgccaccatagtcactctgggtcccgacaactccatcctcagggaagagcaggtatctgtggatctcgtccagaggggtgatgtggtgaaggtggcccctgggggaaagttccctgtggatgggaaggtgatcgagggcagctccatggcggacgagtctctcattactggtgagccaatgccagtcagtaagaagcctggcagctatgtgatcgcgggctccataaacggccacggagcgctgctggtggaggctactcacgtaggggccgacaccacactcagccagatagtcaaactggtcgaggaggcccagacgtcaaaggctcccatccagcagtttgctgataaactgagtggatatttcgtccctttcatcatcctcgtctctgtggtaacactggtggtctggctcatcattgggtttcttgacttcgacattgttgcagaatattttcctggctacgataagaacatcccccacacagacgtgattgtgcgcttcgccttccagacttcgctcacagtcctgtccattgcctgcccctgcgccctgggcctggcaaccccgactgctgtgatggtgggcacgggcgtgggcgcccagaacggcatcctcatcaagggaggggagcccctggagatggcacacaagatcaaggcagtgatgtttgacaagacgggcaccatcaccaacggggtgccgaaggtgacgcgtgtgctagtgctgtgggaccaggcccgcatgcccctgcggaaggttctggctgtcgtgggcacagctgaggccagcagtgaacacccactgggcatggccgtcaccaagcactgcaaacaggagctggacacaaagactctggggttctgccatgacttccaagcagtgccaggctgtggaataagctgcagggtctcgaacatcgacgagctgctgcgcaacctggaccagacggccatcagcctagagacccacctcaccatacagggggccactacagacgagagcatcctgctcaatggatctgaacctgcgtgtaatccaggcacatactcagtgctgattggtaacagagagtggatgaggcgtaacggtctacacatcaccactgatgtggatgaagccatgaccagccatgaaaccaaaggacagactgccatcctagtggccatagacggtgtgctgtgtgccatgttggccatagcggacacagtgaagccagagtctgcgctggctgtccacaccctgcgcagcatgggcatcgatgttgtgatgatcacaggggacaaccgtcgcaccgctaaagccatcgctacacaggtgggcatcaggaaggtgtttgcagaggtgctgccatctcacaaggtggccaaggtgcaggagctgcaggagcagggcctgagggtggccatggtgggcgatggcgtgaacgactcgcccgctcttgcccgcgctgaccttggcattgccatcggcacgggcaccgatgtagccatcgaggcagcggacgtggttctgattaggaatgatcttttggatgtggtggccagtattgagctctcaaagaaaacggtccagaggattcggatcaactttgtttttgctctcatatacaacctgttgggaatcccaattgctgcaggagtgttcatgccagctggtctggtgctgcagccgtggatgggctcagcagcaatggcagcctcctccgtgtcagtggtggtgtcctcattactgctcaggctgtataagaagactccggtggagctgtacgagctcagagcccagggccacatgaagagcctcaacccctctcaggtgagcatccacgtgggcctggacgaccgccaacgcacgcccccatccggccgtcacacctgggacaggcagagccagggcggctatatcccggagtctttgcgaccacccagccaagcagcggaagcaccctcttcctccatcgccctggaccggcgctctctcctggatgatgaaggcgaggtggacttgattgtgtgaccctgcccccttccccctcccaagggcacacacaagcaggaaggaaggaggacacccatcttacatcatggctgttggagattcatgggactatggaccccacggatcctgctgactgaaggtgactagggagacgagtccaaggaaatctgtaaggatcatactggatggctgtgaagaaattaggaatggaagagacatctgattactcagtggacagcaactacacattatcaggggacaatagtgtacttaatagagcacttaatcacatactgtacctttcttttgtatattcaataatagtttactgtggggaatcatttcatttacactgcatcagttaatggatgtcaaatctcaatcatcaaataaagattttactaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]