2024-05-20 08:58:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_012392046 3916 bp mRNA linear INV 10-APR-2020 DEFINITION PREDICTED: Bombus impatiens copper-transporting ATPase 1 (LOC100747704), transcript variant X9, mRNA. ACCESSION XM_012392046 VERSION XM_012392046.3 DBLINK BioProject: PRJNA70395 KEYWORDS RefSeq. SOURCE Bombus impatiens (common eastern bumble bee) ORGANISM Bombus impatiens Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_177694.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Apr 10, 2020 this sequence version replaced XM_012392046.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Bombus impatiens Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3916 /organism="Bombus impatiens" /mol_type="mRNA" /isolation_source="haploid male brothers" /db_xref="taxon:132113" /chromosome="Unknown" /sex="male" /country="USA" gene 1..3916 /gene="LOC100747704" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 105 samples with support for all annotated introns" /db_xref="GeneID:100747704" CDS 203..3916 /gene="LOC100747704" /codon_start=1 /product="copper-transporting ATPase 1 isoform X4" /protein_id="XP_012247469.1" /db_xref="GeneID:100747704" /translation="
MVYVPRSQKIKDSTNISTMKVNIDGMRCQSCVKNIERTIGSRPEVLSVKVILEEKLGYIEYKAEEITPNELVEAIEDMGFAASLCSDESSSTEKIQRSDSLQLTISTCTVHIDGMTCASCVKTIIDSLSQKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFVEEMGFNSFVKEVNGKVLGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDIASSISELGFPTTLIEEPGTGEGDIELKITGMTCASCVNKIESTVRKLPGVRSAAVALATQRGKFKYDVEKIGVRDIIECIDKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLFVWIIVGYVNVNSLPISHNDQIKKHGLNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSETTGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVIEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETSEYLSAMHAHSTARMIDLDTISLHRGLDDTVMPIMHRSTSTLSRLFRRSKDNVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"
misc_feature 260..451 /gene="LOC100747704" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(278..286,293..295) /gene="LOC100747704" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 536..709 /gene="LOC100747704" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(545..553,560..562) /gene="LOC100747704" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 863..1057 /gene="LOC100747704" /note="copper chaperone CopZ; Region: chaper_CopZ_Eh; NF033794" /db_xref="CDD:411374" misc_feature 1088..1276 /gene="LOC100747704" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1106..1114,1121..1123) /gene="LOC100747704" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1355..3616 /gene="LOC100747704" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2348..2350,2354..2356,3485..3487) /gene="LOC100747704" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(2480..2488,2690..2692,2936..2944,3032..3034, 3152..3160,3218..3220,3227..3229,3236..3238,3293..3295, 3302..3304) /gene="LOC100747704" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" misc_feature 2480..2500 /gene="LOC100747704" /note="P-type ATPase signature motif; other site" /db_xref="CDD:319783" misc_feature 2480..2482 /gene="LOC100747704" /note="phosphorylation site [posttranslational modification]" /db_xref="CDD:319783" misc_feature order(3488..3490,3569..3571,3581..3583) /gene="LOC100747704" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" ORIGIN
cgatttggaggaaaatcagtgtaatcggaaagaaatatgtgccctcgatcgtattctaacatttaaacgaataactcgcttcgaagtcgaccgataacgattactttcttttattgtttataaaatgaacgatagctaagctgcttcggttgcataatgcaacgatggggagggcgataccgattacgaaggcacggtacagatggtgtacgttcctcggtcgcagaaaatcaaagattccacgaatatttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagagaaccataggaagccgaccggaggttttgagcgttaaagtaatcctagaagagaagctcggctacatcgaatataaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggtttcgccgcttccctatgcagcgacgaaagtagctctaccgaaaagatacaaagaagtgattcgttacaattaactatcagtacttgtaccgtacatatcgatggaatgacctgcgcgtcttgtgttaaaactatcattgacagtttatcgcagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcttacaacgacaaggacctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgttcgttaaagaagtaaacggtaaagttctaggagaggaaacaccaatgaatttatcgttaaaaaacaattctgcgcaagaggaacttccgttgcaaatgaatggaggaggtgacgtaaagactcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgtcgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtagcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgattgacatcgcttctagcatatcggaattgggcttccctactactttgatcgaggaacctggcaccggagagggagatatcgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattaccgggcgtccgttctgccgctgttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacatcatcgaatgcatcgacaaattaggtttcaccgcaatgttatttagtaacaaagataaagagaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgtttttagtgtccttaatttttggcataccgtgtatgttagccatgacatacttcatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtgcagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagcgatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacatcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttgatcagtatagatttagtacaacggggcgatgttctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtaccgaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaatcactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttattcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaaaaaacacggattgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcgatagcttgtccatgcgcgttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttagtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcggtacgtgaaggaaacaataggctctgaaacaactggacagtgcatgaattttcaagcagttgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaagattaccttctggaacgcataacttaaataacgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttattgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaagatgggtttagaagtcattcttttaacaggagacaatagaaagactgctgtttctatcgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcgatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaatgatcttctagatgttatcgcgtgtctggatctatcgagaaaaacagttcgtcgaataaggttgaattttttatttgctagtatctataatttgttgggtattcctattgctgctggaatatttagttctttcggattcttccttcaaccttggatgtcgtcagcggcgatggctttaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccgacaaagaccactttagaaacatcagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatttagatacaatatctcttcatcgtggtttagatgatactgtaatgcctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacaatgtagagggtcgtctcctaggtgaagatattgatgaaattgatttggtaacagatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]