2024-05-20 10:50:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_012392043 4187 bp mRNA linear INV 10-APR-2020 DEFINITION PREDICTED: Bombus impatiens copper-transporting ATPase 1 (LOC100747704), transcript variant X7, mRNA. ACCESSION XM_012392043 VERSION XM_012392043.3 DBLINK BioProject: PRJNA70395 KEYWORDS RefSeq. SOURCE Bombus impatiens (common eastern bumble bee) ORGANISM Bombus impatiens Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_177694.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Apr 10, 2020 this sequence version replaced XM_012392043.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Bombus impatiens Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4187 /organism="Bombus impatiens" /mol_type="mRNA" /isolation_source="haploid male brothers" /db_xref="taxon:132113" /chromosome="Unknown" /sex="male" /country="USA" gene 1..4187 /gene="LOC100747704" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 136 samples with support for all annotated introns" /db_xref="GeneID:100747704" CDS 375..4187 /gene="LOC100747704" /codon_start=1 /product="copper-transporting ATPase 1 isoform X3" /protein_id="XP_012247466.1" /db_xref="GeneID:100747704" /translation="
MRKFAKTWRYKLLNSTKYLGDGEGDTDYEGTVQMVYVPRSQKIKDSTNISTMKVNIDGMRCQSCVKNIERTIGSRPEVLSVKVILEEKLGYIEYKAEEITPNELVEAIEDMGFAASLCSDESSSTEKIQRSDSLQLTISTCTVHIDGMTCASCVKTIIDSLSQKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFVEEMGFNSFVKEVNGKVLGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDIASSISELGFPTTLIEEPGTGEGDIELKITGMTCASCVNKIESTVRKLPGVRSAAVALATQRGKFKYDVEKIGVRDIIECIDKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLFVWIIVGYVNVNSLPISHNDQIKKHGLNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSETTGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVIEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETSEYLSAMHAHSTARMIDLDTISLHRGLDDTVMPIMHRSTSTLSRLFRRSKDNVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"
misc_feature 531..722 /gene="LOC100747704" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(549..557,564..566) /gene="LOC100747704" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 807..980 /gene="LOC100747704" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(816..824,831..833) /gene="LOC100747704" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1134..1328 /gene="LOC100747704" /note="copper chaperone CopZ; Region: chaper_CopZ_Eh; NF033794" /db_xref="CDD:411374" misc_feature 1359..1547 /gene="LOC100747704" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1377..1385,1392..1394) /gene="LOC100747704" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1626..3887 /gene="LOC100747704" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2619..2621,2625..2627,3756..3758) /gene="LOC100747704" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(2751..2759,2961..2963,3207..3215,3303..3305, 3423..3431,3489..3491,3498..3500,3507..3509,3564..3566, 3573..3575) /gene="LOC100747704" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" misc_feature 2751..2771 /gene="LOC100747704" /note="P-type ATPase signature motif; other site" /db_xref="CDD:319783" misc_feature 2751..2753 /gene="LOC100747704" /note="phosphorylation site [posttranslational modification]" /db_xref="CDD:319783" misc_feature order(3759..3761,3840..3842,3852..3854) /gene="LOC100747704" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" ORIGIN
aagtaatacatataagttggtcgtatcgaagacgaaaataacgcgcgatagttttgaaaattaaacgacaatgctttgatgacgaaacgcgaagaacagaagaatgttattgagtgctcgtatttcaaaaagcacttggtgactcgcagtagttttattttctaatcgacacagagggatagatggattcgaaatttgatcgtgatctgttgatcgttcaaacctataagtgtgtaacgaacgtatttccttcgctttgcctatcgaataactccaattttatcgcgactcaattcgtaaaacattatgctatcgtgacgttctttacattttaacgattactatttcgatttattttatgcaatcgtatcgtaatgcggaagttcgcaaaaacgtggcggtataaattactgaattctacaaaatacttgggcgatggggagggcgataccgattacgaaggcacggtacagatggtgtacgttcctcggtcgcagaaaatcaaagattccacgaatatttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagagaaccataggaagccgaccggaggttttgagcgttaaagtaatcctagaagagaagctcggctacatcgaatataaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggtttcgccgcttccctatgcagcgacgaaagtagctctaccgaaaagatacaaagaagtgattcgttacaattaactatcagtacttgtaccgtacatatcgatggaatgacctgcgcgtcttgtgttaaaactatcattgacagtttatcgcagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcttacaacgacaaggacctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgttcgttaaagaagtaaacggtaaagttctaggagaggaaacaccaatgaatttatcgttaaaaaacaattctgcgcaagaggaacttccgttgcaaatgaatggaggaggtgacgtaaagactcaaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgtcgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtagcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgattgacatcgcttctagcatatcggaattgggcttccctactactttgatcgaggaacctggcaccggagagggagatatcgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattaccgggcgtccgttctgccgctgttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacatcatcgaatgcatcgacaaattaggtttcaccgcaatgttatttagtaacaaagataaagagaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgtttttagtgtccttaatttttggcataccgtgtatgttagccatgacatacttcatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtgcagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagcgatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacatcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttgatcagtatagatttagtacaacggggcgatgttctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtaccgaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaatcactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttattcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaaaaaacacggattgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcgatagcttgtccatgcgcgttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttagtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcggtacgtgaaggaaacaataggctctgaaacaactggacagtgcatgaattttcaagcagttgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaggtaaaaagattaccttctggaacgcataacttaaataacgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttattgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaagatgggtttagaagtcattcttttaacaggagacaatagaaagactgctgtttctatcgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcgatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaatgatcttctagatgttatcgcgtgtctggatctatcgagaaaaacagttcgtcgaataaggttgaattttttatttgctagtatctataatttgttgggtattcctattgctgctggaatatttagttctttcggattcttccttcaaccttggatgtcgtcagcggcgatggctttaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccgacaaagaccactttagaaacatcagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatttagatacaatatctcttcatcgtggtttagatgatactgtaatgcctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacaatgtagagggtcgtctcctaggtgaagatattgatgaaattgatttggtaacagatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]