GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-09-18 20:44:24, GGRNA.v2 : RefSeq release 201 (Jul, 2020)

LOCUS       XM_011545117            1306 bp    mRNA    linear   PRI 28-MAY-2020
DEFINITION  PREDICTED: Homo sapiens membrane spanning 4-domains A12 (MS4A12),
            transcript variant X1, mRNA.
ACCESSION   XM_011545117
VERSION     XM_011545117.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000011.10) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 6, 2016 this sequence version replaced XM_011545117.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200522
            Annotation Version          :: 109.20200522
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1306
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
     gene            1..1306
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="membrane spanning 4-domains A12; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 mRNA, 3 ESTs, 2 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     6 samples with support for all annotated introns"
                     /db_xref="GeneID:54860"
                     /db_xref="HGNC:HGNC:13370"
                     /db_xref="MIM:606550"
     variation       5
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317443102"
     variation       6
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448306006"
     variation       8
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311994183"
     variation       13
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900892144"
     variation       14
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73483202"
     variation       19..21
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1380622229"
     variation       29
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376833871"
     variation       31
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77968411"
     variation       34
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951073607"
     variation       37
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192351947"
     variation       41
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576198710"
     variation       43
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016790007"
     variation       48
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454691277"
     variation       66
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71488477"
     variation       68
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163212354"
     variation       71
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976255870"
     variation       74
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418608004"
     variation       75
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991255142"
     variation       82
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917088183"
     variation       83
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115937965"
     variation       88
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565202046"
     variation       91
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:561193167"
     variation       93
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189301912"
     variation       95
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469736034"
     variation       96
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590857540"
     variation       99
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73485004"
     variation       105
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464060408"
     variation       106
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750728747"
     variation       112
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186187984"
     variation       117
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197441861"
     variation       118
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042935652"
     variation       120
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1039858733"
     variation       125
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901341878"
     variation       126
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311304171"
     variation       129
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1299610283"
     variation       131
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889678341"
     variation       132
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372348083"
     variation       151
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183460796"
     variation       156
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590857573"
     variation       161
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046800748"
     variation       162
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423535566"
     variation       163
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1168590465"
     variation       165
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569754761"
     variation       169
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465712059"
     variation       172
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373599374"
     variation       178
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376173953"
     variation       182
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173685779"
     variation       184
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402765341"
     variation       185
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1455463866"
     variation       200
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756467134"
     CDS             206..1009
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /codon_start=1
                     /product="membrane-spanning 4-domains subfamily A member
                     12 isoform X1"
                     /protein_id="XP_011543419.1"
                     /db_xref="GeneID:54860"
                     /db_xref="HGNC:HGNC:13370"
                     /db_xref="MIM:606550"
                     /translation="
MMSSKPTSHAEVNETIPNPYPPSSFMAPGFQQPLGSINLENQAQGAQRAQPYGITSPGIFASSQPGQGNIQMINPSVGTAVMNFKEEAKALGVIQIMVGLMHIGFGIVLCLISFSFREVLGFASTAVIGGYPFWGGLSFIISGSLSVSASKELSRCLVKGSLGMNIVSSILAFIGVILLLVDMCINGVAGQDYWAVLSGKGISATLMIFSLLEFFVACATAHFANQANTTTNMSVLVIPNMYESNPVTPASSSAPPRCNNYSANAPK"
     misc_feature    473..868
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /note="CD20-like family; Region: CD20; pfam04103"
                     /db_xref="CDD:309291"
     variation       208
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1252684298"
     variation       210
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466963594"
     variation       211
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195128504"
     variation       221
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1242587090"
     variation       228
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778124679"
     variation       231
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754017666"
     variation       232
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225706224"
     variation       233
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457543254"
     variation       234
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12788393"
     variation       240
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757377903"
     variation       242
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1327771401"
     variation       249
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461568056"
     variation       251
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1163741152"
     variation       253
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318571227"
     variation       254
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138899173"
     variation       255
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780090697"
     variation       256
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778749313"
     variation       258
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320728055"
     variation       260
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367773011"
     variation       263
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566039195"
     variation       265
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237273460"
     variation       266
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746776765"
     variation       267
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357430027"
     variation       277
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536385814"
     variation       278
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166856084"
     variation       280
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272742539"
     variation       281
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476442625"
     variation       284
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768355697"
     variation       285
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206636775"
     variation       287
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776245356"
     variation       289
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747699665"
     variation       292
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590859621"
     variation       293
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190923139"
     variation       295
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761750353"
     variation       298
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78557637"
     variation       299
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:370132588"
     variation       299
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760018313"
     variation       308
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767901392"
     variation       309
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775981038"
     variation       310
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1590859657"
     variation       312
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:556326036"
     variation       314
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324209869"
     variation       315
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:901841938"
     variation       319
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754071051"
     variation       323
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026503494"
     variation       328
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160589718"
     variation       329
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434470510"
     variation       333
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757436949"
     variation       335
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1400549241"
     variation       336
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296879315"
     variation       338
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377836379"
     variation       339
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972176383"
     variation       340
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765304283"
     variation       346
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147360952"
     variation       347
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137894801"
     variation       348
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545246635"
     variation       351
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:754835350"
     variation       352
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780842864"
     variation       355
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1214232115"
     variation       356
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747738624"
     variation       361
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2298552"
     variation       362
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775700798"
     variation       363
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772683966"
     variation       364
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480643121"
     variation       365
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420443215"
     variation       368
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182063794"
     variation       369
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775828292"
     variation       370
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143911504"
     variation       374..375
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1219707404"
     variation       375
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148561730"
     variation       376..378
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:778786975"
     variation       376
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201559362"
     variation       379
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777007836"
     variation       380
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537834442"
     variation       381
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765373308"
     variation       383
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1400144812"
     variation       389
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936582018"
     variation       390
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750578686"
     variation       391
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264631697"
     variation       392
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:574629951"
     variation       397
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758389107"
     variation       398..399
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="cc"
                     /replace="cccc"
                     /db_xref="dbSNP:1350291380"
     variation       399
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374598941"
     variation       400..402
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1336419383"
     variation       400
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375239051"
     variation       402
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369153107"
     variation       406
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233489930"
     variation       408
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780895729"
     variation       414
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481324190"
     variation       416
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2298553"
     variation       423
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411022370"
     variation       428
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146116909"
     variation       429
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748869001"
     variation       430
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177094379"
     variation       433
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186155588"
     variation       436
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459596106"
     variation       437
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770305113"
     variation       438
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780726858"
     variation       441
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173560123"
     variation       444
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747462369"
     variation       446
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769148565"
     variation       450
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777203935"
     variation       451
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889178913"
     variation       454
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395992059"
     variation       459..467
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:1351950670"
     variation       463
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762075214"
     variation       464
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008737024"
     variation       468
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540180988"
     variation       472
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439979578"
     variation       473
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299062920"
     variation       474
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309234439"
     variation       476
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78337068"
     variation       479
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751500031"
     variation       482
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565204560"
     variation       484
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140200568"
     variation       485
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013735022"
     variation       487
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781773125"
     variation       489
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217004211"
     variation       493
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285899537"
     variation       494
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143892341"
     variation       503
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213057760"
     variation       510
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442728325"
     variation       511
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258317633"
     variation       512
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550483956"
     variation       513
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778062540"
     variation       516
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410492810"
     variation       519
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201589223"
     variation       521
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867365250"
     variation       523
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157852910"
     variation       528
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546001592"
     variation       530
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436511664"
     variation       531
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590861648"
     variation       532
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771187436"
     variation       534
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151260783"
     variation       540
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1371528920"
     variation       543
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373214880"
     variation       547
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1404706838"
     variation       548
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398563254"
     variation       555
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299493410"
     variation       565
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033263732"
     variation       566
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772088969"
     variation       567
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175190309"
     variation       568
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201122448"
     variation       573
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309023758"
     variation       579
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546836504"
     variation       587
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565204620"
     variation       590..612
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="ggtgg"
                     /replace="ggtggatacccattctggggtgg"
                     /db_xref="dbSNP:770456857"
     variation       590
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237153780"
     variation       592
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891513801"
     variation       593
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764090100"
     variation       594
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139228899"
     variation       597
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761679169"
     variation       598
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150012278"
     variation       604
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758007560"
     variation       608
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765933255"
     variation       609
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751073407"
     variation       610
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1590861711"
     variation       613
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921248024"
     variation       614
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376941266"
     variation       623
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779180638"
     variation       631
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484694112"
     variation       636
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376865209"
     variation       637
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758679368"
     variation       643..647
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:769038765"
     variation       643
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780300796"
     variation       644
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370194824"
     variation       647
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768745030"
     variation       648
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288881477"
     variation       649
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334719730"
     variation       652
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911661661"
     variation       657
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271870796"
     variation       659
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781017742"
     variation       662
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750446764"
     variation       668
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200547614"
     variation       669
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111546873"
     variation       671
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1190907376"
     variation       677
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770710062"
     variation       684
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773888916"
     variation       686
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237852483"
     variation       692
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282472589"
     variation       702
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345072231"
     variation       704..710
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="gtt"
                     /replace="gttagtt"
                     /db_xref="dbSNP:762144058"
     variation       704
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590863027"
     variation       706
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759159950"
     variation       707
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590863036"
     variation       709
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771617330"
     variation       716
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149091457"
     variation       720
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557717418"
     variation       729
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239183503"
     variation       734
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760157189"
     variation       737
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157377925"
     variation       739
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397467541"
     variation       746
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374195006"
     variation       750
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773669521"
     variation       752
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577537930"
     variation       753
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590863067"
     variation       756
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404377711"
     variation       760
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393377065"
     variation       762
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116528387"
     variation       769
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1375872571"
     variation       771
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444358113"
     variation       773..774
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1321800478"
     variation       774
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1365154827"
     variation       775
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1305513054"
     variation       776
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780542886"
     variation       777
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751736928"
     variation       786
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755297132"
     variation       790
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771226235"
     variation       791
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767822239"
     variation       793
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198864842"
     variation       801
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452098521"
     variation       802..805
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:760725549"
     variation       803
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375256547"
     variation       804
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746610650"
     variation       806
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768161466"
     variation       808
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1457274616"
     variation       809
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565206128"
     variation       813
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291677898"
     variation       817
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178787516"
     variation       819
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147819793"
     variation       820
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141480500"
     variation       821
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297049192"
     variation       824
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337891485"
     variation       827
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771505319"
     variation       829
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313072224"
     variation       833
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774676964"
     variation       846
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1244582339"
     variation       850
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759965296"
     variation       851
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147008825"
     variation       852
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559899560"
     variation       855
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262585651"
     variation       862
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921249682"
     variation       864
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761043413"
     variation       865
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764397438"
     variation       866
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1590864682"
     variation       867
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423000621"
     variation       869
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573431813"
     variation       871..874
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:766426334"
     variation       873
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761768684"
     variation       875
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879204053"
     variation       885
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765251191"
     variation       886
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358073839"
     variation       889
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388484219"
     variation       890
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380617165"
     variation       891
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868687955"
     variation       892
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452299840"
     variation       897
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750280122"
     variation       898
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17852697"
     variation       899
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396800822"
     variation       900
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1286542708"
     variation       902
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779760931"
     variation       904
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378021469"
     variation       907
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220974645"
     variation       910
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000885946"
     variation       911
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777213684"
     variation       924
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311741451"
     variation       927
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748792642"
     variation       928
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772755028"
     variation       930
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954156247"
     variation       932
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986828692"
     variation       934
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325382639"
     variation       936
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780675530"
     variation       939
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1590864945"
     variation       942
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747409283"
     variation       948
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768853841"
     variation       950
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191210210"
     variation       951
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961621774"
     variation       953
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776926656"
     variation       954
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748252951"
     variation       955
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:59813271"
     variation       962
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773340421"
     variation       965
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466420382"
     variation       969
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920079485"
     variation       971
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770028029"
     variation       973
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248840884"
     variation       976
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353197104"
     variation       978
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439208171"
     variation       982
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763002323"
     variation       994
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:754928643"
     variation       999
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766347364"
     variation       1000
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774220966"
     variation       1004
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376989014"
     variation       1007
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1318914376"
     variation       1009
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197708518"
     variation       1010
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1255932271"
     variation       1015
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453169491"
     variation       1019
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222211165"
     variation       1021
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767148279"
     variation       1022
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565206377"
     variation       1024
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927070929"
     variation       1025
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752530922"
     variation       1026
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276433368"
     variation       1029
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195237590"
     variation       1037
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755778298"
     variation       1041
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977413948"
     variation       1052
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2298559"
     variation       1053
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201703923"
     variation       1054
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373758551"
     variation       1055
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780728976"
     variation       1058
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747462337"
     variation       1059..1063
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1175201968"
     variation       1059
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349833065"
     variation       1061
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412430651"
     variation       1062
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945951961"
     variation       1066
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042976498"
     variation       1067
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414309506"
     variation       1070..1076
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1173577778"
     variation       1074
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537377916"
     variation       1087
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556994577"
     variation       1090
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:995980841"
     variation       1095
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577132569"
     variation       1096
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590865063"
     variation       1098
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590865067"
     variation       1117..1121
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:933802438"
     variation       1127
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328433128"
     variation       1131
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028793998"
     variation       1132
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050972536"
     variation       1135
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444387860"
     variation       1136
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908434105"
     variation       1138
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749387747"
     variation       1141
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532718489"
     variation       1143
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349685963"
     variation       1145
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008769580"
     variation       1146
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549411971"
     variation       1147
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376939564"
     variation       1150
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565206447"
     variation       1151
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773255438"
     variation       1158
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590865101"
     variation       1163
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539456128"
     variation       1176
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750463834"
     variation       1178
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445326159"
     variation       1193
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485922958"
     variation       1197
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055251913"
     variation       1212
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188517726"
     variation       1213
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378871217"
     variation       1220
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76519292"
     variation       1225
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440883692"
     variation       1226
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384657738"
     variation       1227
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542431954"
     variation       1229
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952821970"
     variation       1241
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562302627"
     variation       1244
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:575828350"
     variation       1246
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766315783"
     variation       1250..1253
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="t"
                     /replace="tctt"
                     /db_xref="dbSNP:1446160611"
     variation       1256
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283657959"
     variation       1264
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448390714"
     variation       1265
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999299683"
     variation       1278
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980296875"
     variation       1282
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927492930"
     variation       1285
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957714593"
     variation       1287
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590865160"
     variation       1292
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:938435969"
     variation       1294
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776398868"
     variation       1299
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358983180"
     variation       1303
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300478541"
     variation       1304
                     /gene="MS4A12"
                     /gene_synonym="Ms4a10"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175906955"
ORIGIN      
tacctataaaatccaggtaaatatctgatactggcacacaggttggagcagagaaagaggaaacatagaggtgccaaaggaacaaaattggagggatgaagacaagttcttgactctatgttgaggccagttgaaaaatgagggagaataaaaccatgaacgaaacaagaaagaaacaaaacagaagaggaatgaaaaagacataatgatgtcatccaagccaacaagccatgctgaagtaaatgaaaccatacccaacccttacccaccaagcagctttatggctcctggatttcaacagcctctgggttcaatcaacttagaaaaccaagctcagggtgctcagcgtgctcagccctacggcatcacatctccgggaatctttgctagcagtcaaccgggtcaaggaaatatacaaatgataaatccaagtgtgggaacagcagtaatgaactttaaagaagaagcaaaggcactaggggtgatccagatcatggttggattgatgcacattggttttggaattgttttgtgtttaatatccttctcttttagagaagtattaggttttgcctctactgctgttattggtggatacccattctggggtggcctttcttttattatctctggctctctctctgtgtcagcatccaaggagctttcccgttgtctggtgaaaggcagcctgggaatgaacattgttagttctatcttggccttcattggagtgattctgctgctggtggatatgtgcatcaatggggtagctggccaagactactgggccgtgctttctggaaaaggcatttcagccacgctgatgatcttctccctcttggagttcttcgtagcttgtgccacagcccattttgccaaccaagcaaacaccacaaccaatatgtctgtcctggttattccaaatatgtatgaaagcaaccctgtgacaccagcgtcttcttcagctcctcccagatgcaacaactactcagctaatgcccctaaatagtaaaagaaaaaggggtatcagtctaatctcatggagaaaaactacttgcaaaaacttcttaagaagatgtcttttattgtctacaatgatttctagtctttaaaaactgtgtttgagatttgtttttaggttggtcgctaatgatggctgtatctcccttcactgtctcttcctacattaccactactacatgctggcaaaggtgaaggatcagaggactgaaaaatgattctgcaactctcttaaagttagaaatgtttctgttcatattactttttccttaataaaatgtcatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]