GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 22:32:22, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_011544901            4521 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens zinc finger DHHC-type palmitoyltransferase
            5 (ZDHHC5), transcript variant X3, mRNA.
ACCESSION   XM_011544901
VERSION     XM_011544901.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000011.10) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4521
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
     gene            1..4521
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /note="zinc finger DHHC-type palmitoyltransferase 5;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 3 mRNAs, 134 ESTs, 187 long SRA reads, 9
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 32 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:25921"
                     /db_xref="HGNC:HGNC:18472"
                     /db_xref="MIM:614586"
     variation       4
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529011149"
     variation       7
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425508802"
     variation       8
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030065688"
     variation       9
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175558768"
     variation       10
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:954475685"
     variation       11..30
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gccgccgccccttccgcccc"
                     /replace="gccgccgccccttccgccccgccgccgccccttccgcccc"
                     /db_xref="dbSNP:528931926"
     variation       12
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307873018"
     variation       13
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:995990611"
     variation       14
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987352563"
     variation       21
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746343440"
     variation       24
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246098821"
     variation       27
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908715113"
     variation       30
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304228365"
     variation       31
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951832260"
     variation       33
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984504172"
     variation       34
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343111577"
     variation       38
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332995908"
     variation       41
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770238013"
     variation       42
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1232357079"
     variation       43
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438293971"
     variation       45
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393391653"
     variation       46
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014593828"
     variation       47
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961979995"
     variation       50
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775681028"
     variation       54
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347107170"
     variation       55
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747860419"
     variation       59
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973021001"
     variation       61
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418621534"
     variation       67
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381038164"
     variation       69
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961894983"
     variation       70..76
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ctctc"
                     /replace="ctctctc"
                     /db_xref="dbSNP:1180692855"
     variation       74
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974385746"
     variation       80
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1252693394"
     variation       91
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193834186"
     variation       93
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210883906"
     variation       95
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928181872"
     variation       99
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919923040"
     variation       102
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:991013975"
     variation       106
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353747378"
     variation       107..112
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1310839658"
     variation       107
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483480127"
     variation       108
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948725060"
     variation       115
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301715199"
     variation       116
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757896531"
     variation       128
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117517505"
     variation       132
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454269940"
     variation       133
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451117611"
     variation       136
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569118843"
     variation       145
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452807648"
     variation       148
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403924963"
     variation       150
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550352618"
     variation       153
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325153345"
     variation       156
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016272210"
     variation       157
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454537251"
     variation       161
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572585564"
     variation       162
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458820662"
     variation       163
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414261422"
     variation       174
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1388516133"
     variation       181
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541232281"
     variation       193
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538926717"
     variation       194
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971618944"
     variation       196
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145187744"
     variation       203..207
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="agata"
                     /db_xref="dbSNP:569612428"
     variation       206
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206223124"
     variation       207
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:977917631"
     variation       208
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443542807"
     variation       209
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295918465"
     variation       210
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923810319"
     variation       214
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1345621060"
     variation       215
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276192797"
     variation       221
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565515330"
     variation       227
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325638088"
     variation       232..233
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1555004570"
     variation       233..235
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:34334967"
     variation       237
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362534143"
     variation       241
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183487765"
     variation       251
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053653121"
     variation       252
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554233260"
     variation       275
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425979579"
     variation       275
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1469316082"
     variation       284
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889437645"
     variation       287
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913239405"
     variation       293
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:942352915"
     variation       294..295
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1241866942"
     variation       301
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218811208"
     variation       307
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272445739"
     variation       311
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041127769"
     variation       320
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900881167"
     variation       330
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203600037"
     variation       331
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323537207"
     variation       355
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245986023"
     variation       356
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280207553"
     variation       358
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475174228"
     variation       360
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338403675"
     variation       366
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994332957"
     variation       376
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189341920"
     variation       386..389
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1230290463"
     variation       387
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886647571"
     variation       390
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1006461994"
     variation       391
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558352506"
     variation       392
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016494975"
     variation       396..397
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="aa"
                     /replace="aattaa"
                     /db_xref="dbSNP:1422119565"
     variation       411
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039981278"
     variation       414
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898287844"
     variation       416
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995669707"
     variation       420
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959627249"
     variation       430
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990794385"
     variation       442
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403332060"
     variation       454
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025403505"
     variation       457
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886792838"
     variation       468
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383779071"
     variation       472
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183512442"
     variation       476
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483898802"
     variation       477
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543215720"
     variation       490
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013280125"
     variation       493
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201875647"
     variation       496
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024632973"
     variation       498
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971672772"
     variation       506
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230183788"
     variation       513..514
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1356927124"
     variation       513
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314201514"
     variation       517
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1381298752"
     variation       519..525
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="agaga"
                     /replace="agagaga"
                     /db_xref="dbSNP:1318900488"
     variation       523
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440046955"
     variation       528..536
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="taaa"
                     /replace="taaattaaa"
                     /db_xref="dbSNP:1001755294"
     variation       528
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308794097"
     variation       529
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779433762"
     variation       532
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957532833"
     variation       543
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923756902"
     variation       547
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1424875907"
     variation       552
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1416539727"
     variation       553
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176009900"
     variation       557
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957895854"
     variation       572..574
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1363695029"
     variation       573
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780989770"
     variation       577
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489755253"
     variation       581
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290715828"
     variation       584
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911114551"
     variation       585
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942616036"
     variation       593
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753042674"
     variation       598
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967424490"
     variation       606
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922296859"
     variation       610
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335339199"
     variation       612
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223150150"
     variation       613
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1555004689"
     variation       632
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929740529"
     variation       638
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235073086"
     variation       644
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1046872755"
     variation       649
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986799570"
     variation       650
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343918570"
     variation       651
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565189358"
     variation       656
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181866738"
     variation       658
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265938935"
     variation       659
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458690249"
     variation       664
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446210798"
     variation       667
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888208673"
     variation       668..673
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:757607622"
     variation       675
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576966622"
     variation       679..694
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gaaatagaaa"
                     /replace="gaaatagaaatagaaa"
                     /db_xref="dbSNP:1400709205"
     variation       693
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942621944"
     variation       698
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183761870"
     variation       703
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1006368418"
     variation       704
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1479186433"
     variation       711
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267666801"
     variation       715
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037874001"
     variation       719
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895364673"
     variation       721
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975321285"
     variation       722
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258814233"
     variation       724
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185338437"
     variation       726
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1329828843"
     variation       731
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1268819748"
     variation       739
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540946209"
     variation       739
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1230260390"
     variation       745
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560581553"
     variation       746
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971158980"
     variation       752
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999602568"
     variation       757
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370178998"
     variation       758
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758784427"
     variation       763..766
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="tc"
                     /replace="tctc"
                     /db_xref="dbSNP:1565189437"
     variation       765
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535152146"
     variation       771
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:118112861"
     variation       773
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3741076"
     variation       782
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476441448"
     variation       786
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157579821"
     variation       788
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467719089"
     variation       791..797
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:572203699"
     variation       793
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176326354"
     variation       795
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434603296"
     variation       801
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401624245"
     variation       805
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1185757326"
     variation       806
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465207101"
     variation       814
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143672960"
     variation       818..819
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1201705652"
     variation       819..824
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1459986581"
     variation       821
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255555237"
     variation       823..826
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1234226002"
     variation       833
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1346556010"
     variation       848
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293738842"
     variation       852
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445386903"
     variation       856
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904827332"
     variation       860
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1555004761"
     variation       861..868
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="tctg"
                     /replace="tctgtctg"
                     /db_xref="dbSNP:1366391177"
     variation       861
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311682466"
     variation       875
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323056161"
     variation       877
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989234100"
     variation       879
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1355544226"
     variation       884
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404701552"
     variation       886
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911063704"
     variation       887
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963988888"
     variation       889
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467232695"
     variation       890
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977117201"
     variation       901
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286367760"
     variation       908
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034584639"
     variation       909
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1391790285"
     variation       918
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745512679"
     variation       938
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929662288"
     variation       943
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:534917191"
     variation       954
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:893362849"
     variation       960..968
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="cttc"
                     /replace="cttcccttc"
                     /db_xref="dbSNP:1201153111"
     variation       968
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484288799"
     variation       980..983
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1011778476"
     variation       992
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204706501"
     variation       994..1000
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="tcat"
                     /replace="tcatcat"
                     /db_xref="dbSNP:1343313577"
     variation       994
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:531810376"
     variation       1010..1011
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1020404210"
     variation       1013
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046780448"
     variation       1015
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909592263"
     variation       1018
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550411610"
     variation       1022
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941095098"
     variation       1023
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258235527"
     variation       1024
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288067157"
     variation       1026
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037865712"
     variation       1054
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769227994"
     variation       1055
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895342781"
     variation       1061
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306956389"
     variation       1069
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180165546"
     variation       1073..1077
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1430087876"
     variation       1079
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:967476744"
     variation       1080
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232774519"
     variation       1087
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:986806249"
     variation       1091
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146858161"
     variation       1095
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963982127"
     variation       1099
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425560945"
     variation       1101..1103
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:36001832"
     variation       1101
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351360558"
     variation       1105
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248587857"
     variation       1106
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1047114764"
     variation       1117
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906798189"
     variation       1124
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999460922"
     variation       1133
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975752038"
     variation       1134
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277173270"
     variation       1139
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423520819"
     variation       1142
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220668829"
     variation       1156
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1432408482"
     variation       1164
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532865626"
     variation       1165
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919877079"
     variation       1167
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781024795"
     variation       1180
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262083903"
     variation       1186
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747951778"
     variation       1187
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769512802"
     variation       1188
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333473603"
     variation       1192
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260388141"
     variation       1194..1204
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ca"
                     /replace="cagatttccca"
                     /db_xref="dbSNP:1287231903"
     variation       1194
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475939980"
     variation       1204
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777719504"
     variation       1205
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462333180"
     variation       1217
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145925852"
     CDS             1218..3365
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /codon_start=1
                     /product="palmitoyltransferase ZDHHC5 isoform X1"
                     /protein_id="XP_011543203.1"
                     /db_xref="GeneID:25921"
                     /db_xref="HGNC:HGNC:18472"
                     /db_xref="MIM:614586"
                     /translation="
MPAESGKRFKPSKYVPVSAAAIFLVGATTLFFAFTCPGLSLYVSPAVPIYNAIMFLFVLANFSMATFMDPGIFPRAEEDEDKEDDFRAPLYKTVEIKGIQVRMKWCATCRFYRPPRCSHCSVCDNCVEEFDHHCPWVNNCIGRRNYRYFFLFLLSLTAHIMGVFGFGLLYVLYHIEELSGVRTAVTMAVMCVAGLFFIPVAGLTGFHVVLVARGRTTNEQVTGKFRGGVNPFTNGCCNNVSRVLCSSPAPRYLGRPKKEKTIVIRPPFLRPEVSDGQITVKIMDNGIQGELRRTKSKGSLEITESQSADAEPPPPPKPDLSRYTGLRTHLGLATNEDSSLLAKDSPPTPTMYKYRPGYSSSSTSAAMPHSSSAKLSRGDSLKEPTSIAESSRHPSYRSEPSLEPESFRSPTFGKSFHFDPLSSGSRSSSLKSAQGTGFELGQLQSIRSEGTTSTSYKSLANQTRNGSLSYDSLLTPSDSPDFESVQAGPEPDPPLGYTSPFLSARLAQQREAERHPRLVPTGPTHREPSPVRYDNLSRHIVASLQEREKLLRQSPPLPGREEEPGLGDSGIQSTPGSGHAPRTSSSSDDSKRSPLGKTPLGRPAVPRFGKPDGLRGRGVGSPEPGPTAPYLGRSMSYSSQKAQPGVSETEEVALQPLLTPKDEVQLKTTYSKSNGQPKSLGSASPGPGQPPLSSPTRGGVKKVSGVGGTTYEISV"
     misc_feature    1512..1889
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /note="DHHC palmitoyltransferase; Region: zf-DHHC;
                     pfam01529"
                     /db_xref="CDD:279823"
     variation       1218
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413040024"
     variation       1223
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376453110"
     variation       1224
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161031116"
     variation       1225
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139866286"
     variation       1226
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773705321"
     variation       1229
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759301739"
     variation       1230
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771834783"
     variation       1232
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775221417"
     variation       1235
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300942959"
     variation       1237..1241
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1450357621"
     variation       1239
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201316868"
     variation       1242
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765653753"
     variation       1244
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755869967"
     variation       1246
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773791423"
     variation       1248
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354941503"
     variation       1249
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763345795"
     variation       1250
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766518682"
     variation       1252
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751585426"
     variation       1255
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210229869"
     variation       1262
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181601350"
     variation       1264
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754995088"
     variation       1265
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142098848"
     variation       1268
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178943744"
     variation       1270
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380683094"
     variation       1277
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755926737"
     variation       1278
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777412510"
     variation       1281
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749290840"
     variation       1287
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018063251"
     variation       1290
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964246743"
     variation       1300
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334933004"
     variation       1301
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757140213"
     variation       1303
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446444211"
     variation       1304
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344488725"
     variation       1305
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1228434496"
     variation       1316
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778545501"
     variation       1319
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289597986"
     variation       1320
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1364186570"
     variation       1321
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565709623"
     variation       1323
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274796492"
     variation       1324
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452032579"
     variation       1325
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008230480"
     variation       1326
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431625781"
     variation       1328
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565192832"
     variation       1337
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776812550"
     variation       1340
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246394144"
     variation       1350
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150741412"
     variation       1359
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749619862"
     variation       1367
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246579755"
     variation       1369
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972763987"
     variation       1370
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771288681"
     variation       1374
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774742535"
     variation       1388
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230485376"
     variation       1389
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191868466"
     variation       1399
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372486893"
     variation       1403
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960626668"
     variation       1405
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406370866"
     variation       1406
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322412500"
     variation       1412
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990676055"
     variation       1414
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296630954"
     variation       1416
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382691579"
     variation       1418
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449203712"
     variation       1419
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775547295"
     variation       1420
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760948018"
     variation       1431
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186566239"
     variation       1433
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339349984"
     variation       1441
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216715899"
     variation       1448
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139913783"
     variation       1457
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776736903"
     variation       1461
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762070478"
     variation       1477
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201362018"
     variation       1494
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258791232"
     variation       1498
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973737257"
     variation       1499
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187535393"
     variation       1500
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367081679"
     variation       1508
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149824916"
     variation       1525
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449840021"
     variation       1529
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763040057"
     variation       1530
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766431909"
     variation       1532
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751503725"
     variation       1533
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754471008"
     variation       1534
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780731738"
     variation       1535
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752333870"
     variation       1536
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755790071"
     variation       1538
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041012361"
     variation       1539
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201279144"
     variation       1545
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746247101"
     variation       1546
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772358812"
     variation       1557
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224128097"
     variation       1559
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402750033"
     variation       1561
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780566939"
     variation       1569
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747499327"
     variation       1571
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377349008"
     variation       1574
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378811258"
     variation       1589
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352588519"
     variation       1592
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932542538"
     variation       1594
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1430395477"
     variation       1598
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948535349"
     variation       1604
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774193073"
     variation       1608
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565195736"
     variation       1616
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470004749"
     variation       1622
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759453439"
     variation       1634
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332533650"
     variation       1640
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432055278"
     variation       1644
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196664225"
     variation       1645
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425616264"
     variation       1646
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767507873"
     variation       1647
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775848779"
     variation       1648
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413015609"
     variation       1656
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775226876"
     variation       1657
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760212330"
     variation       1661
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315426053"
     variation       1668
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427231666"
     variation       1687
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459292423"
     variation       1688
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763542561"
     variation       1690
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923579468"
     variation       1691
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753535561"
     variation       1694
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756868561"
     variation       1695
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766793236"
     variation       1702
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540403908"
     variation       1703
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927411836"
     variation       1706
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755240484"
     variation       1720
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168003657"
     variation       1721
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306080379"
     variation       1722
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781723870"
     variation       1728
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748555387"
     variation       1733
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487963982"
     variation       1734
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756313651"
     variation       1735
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777968654"
     variation       1741
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477886343"
     variation       1748
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937156063"
     variation       1749
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749589147"
     variation       1758
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147968554"
     variation       1759
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778949371"
     variation       1760
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867847060"
     variation       1761
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745682461"
     variation       1762
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141814126"
     variation       1765
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203007766"
     variation       1766
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424242131"
     variation       1769
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301592533"
     variation       1771
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775517079"
     variation       1773
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306179119"
     variation       1774
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760580339"
     variation       1782
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372679034"
     variation       1785
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756686024"
     variation       1786
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378875452"
     variation       1787
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005567898"
     variation       1797..1798
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1310944742"
     variation       1799
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778059172"
     variation       1802
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753982730"
     variation       1806
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757342722"
     variation       1815
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313505757"
     variation       1820
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210686166"
     variation       1823
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236882443"
     variation       1827
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779231079"
     variation       1828
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199628795"
     variation       1829
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771946959"
     variation       1838
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779678659"
     variation       1839
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752124059"
     variation       1845
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373194517"
     variation       1850
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768564488"
     variation       1855
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443715338"
     variation       1857
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776492494"
     variation       1858
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761315745"
     variation       1860
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328910163"
     variation       1861
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769146020"
     variation       1882
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220362529"
     variation       1883
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200838978"
     variation       1888
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338455119"
     variation       1893
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565196704"
     variation       1894
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772593175"
     variation       1900
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749028649"
     variation       1907
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201799035"
     variation       1910
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770503441"
     variation       1916
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774084067"
     variation       1918
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479520642"
     variation       1929
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196440569"
     variation       1933
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202086190"
     variation       1934
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475266868"
     variation       1936
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452904326"
     variation       1937
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761155822"
     variation       1939
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764507887"
     variation       1940
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777330605"
     variation       1942
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302191728"
     variation       1952
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363148791"
     variation       1953
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401334555"
     variation       1958
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767693799"
     variation       1962
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762191819"
     variation       1964
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325789264"
     variation       1968
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765420329"
     variation       1970
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357557085"
     variation       1974
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372941355"
     variation       1975
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261385256"
     variation       1978
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372678921"
     variation       1983
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111759373"
     variation       1984
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113676480"
     variation       1990
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225609539"
     variation       1995
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765673107"
     variation       1996
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225256502"
     variation       2004
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203877395"
     variation       2007
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281379428"
     variation       2011
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462018696"
     variation       2014
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565197199"
     variation       2016
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773699719"
     variation       2017
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762972870"
     variation       2026
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145352118"
     variation       2038
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34222968"
     variation       2042
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755189183"
     variation       2053
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375821487"
     variation       2055
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:555521374"
     variation       2059
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402859919"
     variation       2064
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755872872"
     variation       2072
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777605730"
     variation       2080
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378923513"
     variation       2081
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753763230"
     variation       2085
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947884639"
     variation       2086
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981994908"
     variation       2089
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778539481"
     variation       2090
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275708614"
     variation       2092
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759072765"
     variation       2099
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2850832"
     variation       2101
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745578833"
     variation       2102
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324902231"
     variation       2107
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763930944"
     variation       2110
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479461342"
     variation       2112..2135
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="agcctggagataacagagagccag"
                     /replace="agcctggagataacagagagccagcctggagataacagagagccag"
                     /db_xref="dbSNP:1565198086"
     variation       2112
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211337616"
     variation       2115
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490421145"
     variation       2117
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969125169"
     variation       2119
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753762468"
     variation       2124
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374103668"
     variation       2127
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197131318"
     variation       2130
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778619518"
     variation       2132
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749964183"
     variation       2134
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112252367"
     variation       2135
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1169503943"
     variation       2142
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349863199"
     variation       2147
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377749811"
     variation       2152
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779602654"
     variation       2156
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771877390"
     variation       2157
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149169388"
     variation       2158
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778169032"
     variation       2165
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547457280"
     variation       2168
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342942665"
     variation       2171
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771442798"
     variation       2174
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143307006"
     variation       2175
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774774294"
     variation       2179
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965310064"
     variation       2181
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759645860"
     variation       2182
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292080932"
     variation       2184
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358056573"
     variation       2185
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772093043"
     variation       2186
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265179879"
     variation       2188
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775626241"
     variation       2189
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325931140"
     variation       2190
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185930007"
     variation       2191
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760923152"
     variation       2197
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147331802"
     variation       2198
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1165647820"
     variation       2202
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753649128"
     variation       2207
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140343860"
     variation       2208
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765267810"
     variation       2209
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380196118"
     variation       2211
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1783978"
     variation       2217
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432073377"
     variation       2218
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778330860"
     variation       2221
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760600324"
     variation       2226
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765889349"
     variation       2231
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:764605341"
     variation       2231
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304698113"
     variation       2238
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165507531"
     variation       2242..2243
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="agtgaatggga"
                     /db_xref="dbSNP:752108277"
     variation       2242
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313894788"
     variation       2243..2244
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="ttttgccggg"
                     /db_xref="dbSNP:757729360"
     variation       2245..2246
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="aat"
                     /db_xref="dbSNP:767836022"
     variation       2247
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150928534"
     variation       2248
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751094074"
     variation       2251
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754380974"
     variation       2252..2257
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:750782730"
     variation       2252
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273377259"
     variation       2253
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142617104"
     variation       2254
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752300151"
     variation       2256
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757669972"
     variation       2257
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574352985"
     variation       2258
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758935084"
     variation       2259
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780363378"
     variation       2261
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234845384"
     variation       2263
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245120855"
     variation       2264
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747113542"
     variation       2266
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768575668"
     variation       2269
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176707936"
     variation       2271
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405962116"
     variation       2272
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481704387"
     variation       2273
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394427404"
     variation       2274
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177842166"
     variation       2276
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405777031"
     variation       2280
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367765828"
     variation       2281
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371292413"
     variation       2284
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183544157"
     variation       2285
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778184833"
     variation       2287
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162113774"
     variation       2288
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440757553"
     variation       2293
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354225419"
     variation       2296
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773135992"
     variation       2297
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144616026"
     variation       2301
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762856116"
     variation       2305
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372591056"
     variation       2311
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774116218"
     variation       2315
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282588954"
     variation       2320
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557105851"
     variation       2321
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374809195"
     variation       2327
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948930507"
     variation       2329
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752390296"
     variation       2332
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757584950"
     variation       2333
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765651515"
     variation       2334
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774615080"
     variation       2336
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490876050"
     variation       2345
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766628269"
     variation       2346
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189780817"
     variation       2347
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755434833"
     variation       2349
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752838265"
     variation       2353
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756223712"
     variation       2354
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778165426"
     variation       2355
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749451307"
     variation       2356
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770802108"
     variation       2363
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951590947"
     variation       2364
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180799222"
     variation       2367
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234220602"
     variation       2370
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778571304"
     variation       2371
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138361806"
     variation       2374
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455054410"
     variation       2376
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385277819"
     variation       2380
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775334864"
     variation       2381
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760205967"
     variation       2382
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:573900463"
     variation       2385
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776391664"
     variation       2387
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285613445"
     variation       2389
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761343422"
     variation       2391
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766835263"
     variation       2392
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149239636"
     variation       2394
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396879009"
     variation       2396
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444864093"
     variation       2400
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:941340909"
     variation       2401
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754502306"
     variation       2405
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055838647"
     variation       2406
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753206290"
     variation       2407
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372245069"
     variation       2414
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194198567"
     variation       2415
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764235975"
     variation       2418
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1398676059"
     variation       2419
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754153794"
     variation       2420
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540535269"
     variation       2432
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913666295"
     variation       2433
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779135039"
     variation       2439
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745651062"
     variation       2440
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758154197"
     variation       2443..2447
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:1241281829"
     variation       2445
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338214006"
     variation       2447
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779992175"
     variation       2453
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350577705"
     variation       2456
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207466821"
     variation       2457
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270219692"
     variation       2458
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181243282"
     variation       2461
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353102504"
     variation       2466
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768197958"
     variation       2468
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565199596"
     variation       2471
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555991599"
     variation       2472
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202592674"
     variation       2474
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144519863"
     variation       2476
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747893595"
     variation       2477
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201301873"
     variation       2479
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148426894"
     variation       2480
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409252936"
     variation       2481
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1418914010"
     variation       2483
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242588732"
     variation       2489
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760000759"
     variation       2493
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767969934"
     variation       2497
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776178608"
     variation       2504
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429704833"
     variation       2507
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565199632"
     variation       2510
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416033034"
     variation       2514
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767784186"
     variation       2516
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469121546"
     variation       2530
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187465053"
     variation       2538
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486225577"
     variation       2539
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761258036"
     variation       2541
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400353385"
     variation       2542
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143221715"
     variation       2543
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753873266"
     variation       2544
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372481022"
     variation       2547
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765413074"
     variation       2549
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750598796"
     variation       2552
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758242125"
     variation       2553
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332012482"
     variation       2554
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893087524"
     variation       2556
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779795853"
     variation       2557
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747017396"
     variation       2563
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754897844"
     variation       2567
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249172363"
     variation       2570
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34147084"
     variation       2571
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233485097"
     variation       2573
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357161691"
     variation       2584
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747822054"
     variation       2585
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269557260"
     variation       2588
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147498002"
     variation       2592
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200638493"
     variation       2596
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748917437"
     variation       2597
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758222553"
     variation       2606
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355112887"
     variation       2607
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377222880"
     variation       2608
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199708132"
     variation       2611
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369287219"
     variation       2612
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145419587"
     variation       2617..2619
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="gcc"
                     /db_xref="dbSNP:1475629589"
     variation       2617
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756538740"
     variation       2621
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777151417"
     variation       2624
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761825768"
     variation       2627
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765341077"
     variation       2630
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420486396"
     variation       2632
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750687958"
     variation       2633
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997646967"
     variation       2641
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299635410"
     variation       2642
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763160181"
     variation       2643
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227671368"
     variation       2644
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250434113"
     variation       2648
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140216066"
     variation       2649
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766222437"
     variation       2651
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751371240"
     variation       2652
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454366071"
     variation       2653
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174948518"
     variation       2664
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490165292"
     variation       2666
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754735960"
     variation       2670
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564457612"
     variation       2677
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373759490"
     variation       2680
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281254346"
     variation       2681
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026091878"
     variation       2685
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752657594"
     variation       2698
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352207420"
     variation       2707
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460942772"
     variation       2709
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755618812"
     variation       2711
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389793571"
     variation       2712
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777416865"
     variation       2713
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749005296"
     variation       2717
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17852426"
     variation       2720
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770718748"
     variation       2721
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778639640"
     variation       2728
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462165020"
     variation       2730
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1351898814"
     variation       2733
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292340207"
     variation       2735
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145627094"
     variation       2736
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383156086"
     variation       2737
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397670068"
     variation       2744
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769020656"
     variation       2745
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116848448"
     variation       2746
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373745864"
     variation       2747
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139706201"
     variation       2749..2750
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1358168831"
     variation       2750
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773268414"
     variation       2763
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1262456376"
     variation       2765
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372160509"
     variation       2766
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766593179"
     variation       2767
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002203232"
     variation       2771
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032703686"
     variation       2773
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751741604"
     variation       2774
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185698020"
     variation       2778
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149770457"
     variation       2784
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:910128674"
     variation       2792
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370888637"
     variation       2793
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756062607"
     variation       2794
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145781238"
     variation       2795
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454578154"
     variation       2799
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753400026"
     variation       2800
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148944485"
     variation       2804
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454227328"
     variation       2805
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778725894"
     variation       2807
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745516699"
     variation       2811
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755342726"
     variation       2812
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377713451"
     variation       2813..2820
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="ttacgaca"
                     /db_xref="dbSNP:1565199914"
     variation       2815
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1346175869"
     variation       2816
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188205473"
     variation       2817
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770350212"
     variation       2818
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145455311"
     variation       2819
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265971493"
     variation       2821
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749401671"
     variation       2823
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1205752647"
     variation       2823
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1244008232"
     variation       2824
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770950225"
     variation       2826
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774596287"
     variation       2827
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759799669"
     variation       2828
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767273060"
     variation       2829
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775367827"
     variation       2830
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532976356"
     variation       2832
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1054182086"
     variation       2833
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1336909277"
     variation       2835
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370388574"
     variation       2836
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892973303"
     variation       2840
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943264419"
     variation       2841
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445439106"
     variation       2842
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299377549"
     variation       2843
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560873780"
     variation       2844
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764155996"
     variation       2845
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1223120780"
     variation       2848
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427346023"
     variation       2849
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286401902"
     variation       2852
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325365663"
     variation       2856
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170427820"
     variation       2857
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757881489"
     variation       2860
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223898223"
     variation       2863
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374833585"
     variation       2871
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777273946"
     variation       2872
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563009033"
     variation       2873
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764812301"
     variation       2878
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481014369"
     variation       2880
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750112392"
     variation       2881
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146478161"
     variation       2884
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779516734"
     variation       2885
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200996194"
     variation       2886
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749763289"
     variation       2890
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141128639"
     variation       2891
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200500149"
     variation       2895
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144913818"
     variation       2896
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772341043"
     variation       2897
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746936322"
     variation       2904
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431149047"
     variation       2909
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775532092"
     variation       2911
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763955816"
     variation       2912
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202026108"
     variation       2913
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314053533"
     variation       2918
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368906243"
     variation       2919
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217640850"
     variation       2927
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761842597"
     variation       2929
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308086485"
     variation       2932
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764900239"
     variation       2947
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555314929"
     variation       2948
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013760724"
     variation       2950
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200035396"
     variation       2951
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757781346"
     variation       2953
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766088842"
     variation       2955
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751124831"
     variation       2957
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756519952"
     variation       2961
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419798204"
     variation       2962
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567126462"
     variation       2966
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166158956"
     variation       2968
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1366971762"
     variation       2969
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425197971"
     variation       2975
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322836468"
     variation       2979
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373177270"
     variation       2980
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770961542"
     variation       2982
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272085236"
     variation       2988
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779219860"
     variation       2990
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479581056"
     variation       2992
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867573006"
     variation       2998
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250691063"
     variation       3001
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148272429"
     variation       3006
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771993457"
     variation       3008
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780368159"
     variation       3017
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747198806"
     variation       3021
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200806457"
     variation       3022
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776556271"
     variation       3025
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776546483"
     variation       3027
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294226143"
     variation       3032
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375000419"
     variation       3035
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448496362"
     variation       3036
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772985153"
     variation       3037
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180768308"
     variation       3041
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298089751"
     variation       3045
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1444747517"
     variation       3051
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462090469"
     variation       3058
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162511563"
     variation       3059
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023247441"
     variation       3060
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388504017"
     variation       3062
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401799413"
     variation       3064
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765785637"
     variation       3066
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138138603"
     variation       3067
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759175821"
     variation       3070
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434623901"
     variation       3072
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767097794"
     variation       3074
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754204600"
     variation       3075
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245620373"
     variation       3077
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757575688"
     variation       3079
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009494095"
     variation       3083
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1417069179"
     variation       3086
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020788621"
     variation       3087
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779493997"
     variation       3089
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545902836"
     variation       3090
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177682288"
     variation       3092
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269129813"
     variation       3094
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464746437"
     variation       3095
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1417610872"
     variation       3096
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206392078"
     variation       3097
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758542607"
     variation       3099
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458297384"
     variation       3101
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779997555"
     variation       3103
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954582935"
     variation       3108
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141172250"
     variation       3110
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745703882"
     variation       3115
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201530882"
     variation       3117
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1159129880"
     variation       3118
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117135042"
     variation       3119
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455474706"
     variation       3120
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1306960223"
     variation       3121
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392436244"
     variation       3124
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318712636"
     variation       3125
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1408594619"
     variation       3128
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263028996"
     variation       3131
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396889175"
     variation       3134
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769428298"
     variation       3136
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773251350"
     variation       3141
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1039343977"
     variation       3143
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540728880"
     variation       3146
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770532208"
     variation       3148..3149
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1323231416"
     variation       3148
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226956353"
     variation       3150
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394841448"
     variation       3157
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1164616409"
     variation       3158
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769554945"
     variation       3162
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758977759"
     variation       3164..3171
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:749408941"
     variation       3175
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767187645"
     variation       3176
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752294339"
     variation       3179
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765484436"
     variation       3181
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250998074"
     variation       3183
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751002788"
     variation       3185
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1292533410"
     variation       3196
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758821826"
     variation       3197
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751696504"
     variation       3198
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755071307"
     variation       3199
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781589368"
     variation       3201
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376273046"
     variation       3203
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879185625"
     variation       3207
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757026709"
     variation       3213
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956021315"
     variation       3217
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1011570501"
     variation       3218
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257428761"
     variation       3221
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778867496"
     variation       3222
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771633111"
     variation       3227
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298669736"
     variation       3228
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774964321"
     variation       3231
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1021655542"
     variation       3238
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750924782"
     variation       3239
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768199834"
     variation       3240
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763250546"
     variation       3244
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766828692"
     variation       3246
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775041221"
     variation       3250
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893874851"
     variation       3251
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760117283"
     variation       3252
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488002170"
     variation       3253
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207826931"
     variation       3257
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238252605"
     variation       3261
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768078038"
     variation       3262
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573191349"
     variation       3263
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760767828"
     variation       3264
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374080912"
     variation       3265
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764244850"
     variation       3266
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923105748"
     variation       3270
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754065745"
     variation       3271
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167449742"
     variation       3273
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150286584"
     variation       3279
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377763198"
     variation       3280
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778672956"
     variation       3281
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432926167"
     variation       3284
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750415345"
     variation       3285
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435334775"
     variation       3286
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758348552"
     variation       3288
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779902189"
     variation       3293
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746536011"
     variation       3296
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555914167"
     variation       3302
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780757864"
     variation       3304
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766814291"
     variation       3305
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371222737"
     variation       3307
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262248220"
     variation       3317
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950502134"
     variation       3318
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:983176652"
     variation       3319
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773659741"
     variation       3324
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465197452"
     variation       3329..3330
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:772036824"
     variation       3329
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774845047"
     variation       3330
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463557364"
     variation       3331
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971017384"
     variation       3344
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381531396"
     variation       3349
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183660824"
     variation       3353
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160943646"
     variation       3359
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199525387"
     variation       3360
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776015908"
     variation       3364
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163353080"
     variation       3366
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760716857"
     variation       3368
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926864588"
     variation       3370
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764199512"
     variation       3371
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754070531"
     variation       3372
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530650676"
     variation       3375
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200117655"
     variation       3377
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765382865"
     variation       3382
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750225456"
     variation       3387
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488481131"
     variation       3388
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376192237"
     variation       3389
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779883003"
     variation       3390..3395
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="cgcctc"
                     /replace="cgcctcgcctc"
                     /db_xref="dbSNP:1208590491"
     variation       3390
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370314176"
     variation       3391
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374038596"
     variation       3398
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367986917"
     variation       3399
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747814809"
     variation       3401
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042423140"
     variation       3402
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003018673"
     variation       3404
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769574039"
     variation       3405
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300617283"
     variation       3409
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544848422"
     variation       3415
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746256502"
     variation       3417
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482979842"
     variation       3418
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113438323"
     variation       3419
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187067974"
     variation       3428
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358077662"
     variation       3436
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563072034"
     variation       3440
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417008240"
     variation       3446
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021542860"
     variation       3448
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578260699"
     variation       3455
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996246810"
     variation       3456
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900407308"
     variation       3475..3480
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="acc"
                     /replace="accacc"
                     /db_xref="dbSNP:1256508960"
     variation       3477
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565200820"
     variation       3480
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210977181"
     variation       3481
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030861577"
     variation       3495
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954552900"
     variation       3497
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983325336"
     variation       3498
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907788028"
     variation       3509
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341536861"
     variation       3518
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963259473"
     variation       3523
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886246094"
     variation       3525
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777279157"
     variation       3532
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545695706"
     variation       3533
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186968752"
     variation       3536
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971090599"
     variation       3539
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352219254"
     variation       3544
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947738137"
     variation       3545
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749685518"
     variation       3546
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1001192526"
     variation       3553
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465762791"
     variation       3555
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377676938"
     variation       3557
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185609907"
     variation       3562
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033964953"
     variation       3565..3571
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:959869519"
     variation       3565
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371268180"
     variation       3569
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316245157"
     variation       3570
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751150913"
     variation       3571..3583
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ctttta"
                     /replace="cttttatctttta"
                     /db_xref="dbSNP:1260224393"
     variation       3576
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112723301"
     variation       3585
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938844527"
     variation       3587
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548684500"
     variation       3588
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314103542"
     variation       3609
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053181653"
     variation       3610
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560675239"
     variation       3617
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330004758"
     variation       3623
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978188101"
     variation       3625
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402090556"
     variation       3627
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215942473"
     variation       3628
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243741271"
     variation       3634
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374462812"
     variation       3635
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531302092"
     variation       3641
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043716218"
     variation       3642
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549605761"
     variation       3651
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571117196"
     variation       3654
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166851623"
     variation       3665
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1417163697"
     variation       3667
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:900488382"
     variation       3670
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1237493904"
     variation       3679
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178173845"
     variation       3680..3687
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="tt"
                     /replace="ttt"
                     /replace="tttt"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:rs1039429921"
     variation       3682
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996605129"
     variation       3685
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1030415377"
     variation       3687
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182734956"
     variation       3688
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:890580895"
     variation       3693
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1208244559"
     variation       3697
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1385640460"
     variation       3698
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:921932944"
     variation       3702
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1004981210"
     variation       3706
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1309152390"
     variation       3707..3713
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1315729921"
     variation       3713..3717
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="tc"
                     /replace="tcctc"
                     /db_xref="dbSNP:1048938231"
     variation       3716
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1407598981"
     variation       3720
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761292789"
     variation       3723
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320447388"
     variation       3724
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781157668"
     variation       3728..3729
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1452567831"
     variation       3731
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004714801"
     variation       3732..3741
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gtgtgtgtgt"
                     /replace="gtgtgtgtgtgt"
                     /db_xref="dbSNP:1337726052"
     variation       3732
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045540894"
     variation       3737
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159149822"
     variation       3740
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149110165"
     variation       3746..3751
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ata"
                     /replace="ataata"
                     /db_xref="dbSNP:1001229607"
     variation       3747
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197036708"
     variation       3748..3749
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1555010332"
     variation       3748..3749
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1491513075"
     variation       3748
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:963217704"
     variation       3749..3766
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="atatatatat"
                     /replace="atatatatatatat"
                     /replace="atatatatatatatat"
                     /replace="atatatatatatatatat"
                     /replace="atatatatatatatatatat"
                     /replace="atatatatatatatatatatat"
                     /replace="atatatatatatatatatatatat"
                     /replace="atatatatatatatatatatatatat"
                     /db_xref="dbSNP:rs10633679"
     variation       3753
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1331389906"
     variation       3756..3757
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:138094238"
     variation       3764
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1247653126"
     variation       3766..3767
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1491299857"
     variation       3766..3767
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1491478335"
     variation       3767
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:868633633"
     variation       3768
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1326538217"
     variation       3768
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298753509"
     variation       3769
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023995996"
     variation       3773
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565201052"
     variation       3777..3783
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="aaa"
                     /replace="aaagaaa"
                     /db_xref="dbSNP:1022543555"
     variation       3780
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223845237"
     variation       3783
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969078407"
     variation       3787
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378475480"
     variation       3788
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190229110"
     variation       3790
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477060027"
     variation       3794
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:912000651"
     variation       3805
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966120493"
     variation       3809
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767029045"
     variation       3815..3836
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ggaggg"
                     /replace="ggagggatacatatacggaggg"
                     /db_xref="dbSNP:1489595011"
     variation       3822
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182445440"
     variation       3825
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199440262"
     variation       3828
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921936858"
     variation       3830
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176590786"
     variation       3831
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278525312"
     variation       3844
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1401608449"
     variation       3845
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866148578"
     variation       3847
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333403068"
     variation       3850
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227183926"
     variation       3851
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1049487179"
     variation       3853
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402944226"
     variation       3859
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174550832"
     variation       3864
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907783455"
     variation       3884
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2956980"
     variation       3887
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045569950"
     variation       3892
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913374157"
     variation       3903..3914
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="gttccctctcat"
                     /db_xref="dbSNP:1469701840"
     variation       3907
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442516928"
     variation       3908
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534233979"
     variation       3910
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177813725"
     variation       3912
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409004448"
     variation       3923
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257583608"
     variation       3928
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1196367195"
     variation       3934
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947585743"
     variation       3935
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745756836"
     variation       3939
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220290094"
     variation       3943
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900791625"
     variation       3944
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448595390"
     variation       3946
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341149184"
     variation       3947
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328677429"
     variation       3950
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931994591"
     variation       3952
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052167981"
     variation       3954
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442498982"
     variation       3963
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467543916"
     variation       3964
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280749006"
     variation       3976
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163200563"
     variation       3978
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555777289"
     variation       3979
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937098947"
     variation       3984
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186895390"
     variation       3990..3992
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="gtg"
                     /db_xref="dbSNP:1456913882"
     variation       3991
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1783979"
     variation       4011
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015043309"
     variation       4012..4013
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1022533033"
     variation       4012
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556656677"
     variation       4013
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191335096"
     variation       4025
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573240140"
     variation       4026
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902755790"
     variation       4027
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306965548"
     variation       4030..4035
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gag"
                     /replace="gaggag"
                     /db_xref="dbSNP:539108587"
     variation       4031
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779756699"
     variation       4032
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999709573"
     variation       4035
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332330018"
     variation       4039
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019086466"
     variation       4054
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995117232"
     variation       4058
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323385736"
     variation       4060
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023543449"
     variation       4073
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406303657"
     variation       4074
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368059182"
     variation       4092
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969676755"
     variation       4103
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982053898"
     variation       4105
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545235411"
     variation       4112
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380323737"
     variation       4117
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956386202"
     variation       4124
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029074645"
     variation       4129
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114728264"
     variation       4133
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245756993"
     variation       4149
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749484276"
     variation       4153
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464572656"
     variation       4157
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1167641061"
     variation       4159
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182641182"
     variation       4160
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907814425"
     variation       4161
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353098981"
     variation       4162
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968857013"
     variation       4164
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309982549"
     variation       4167
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225533385"
     variation       4169
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979374851"
     variation       4175
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:922133571"
     variation       4177
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981326951"
     variation       4181
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:928459922"
     variation       4183
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1296910997"
     variation       4184..4188
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gtg"
                     /replace="gtgtg"
                     /db_xref="dbSNP:1419568751"
     variation       4184
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932189029"
     variation       4185
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:542258855"
     variation       4194
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361730040"
     variation       4199
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937150034"
     variation       4201
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560537280"
     variation       4205
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531168465"
     variation       4206
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052033215"
     variation       4210
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188783024"
     variation       4225
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191377573"
     variation       4229
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478900895"
     variation       4231
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564608565"
     variation       4235
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192856806"
     variation       4239
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940694633"
     variation       4247
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947065346"
     variation       4254
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768977808"
     variation       4268
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288054683"
     variation       4277
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143262971"
     variation       4278
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899282108"
     variation       4291
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1310485639"
     variation       4292
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994938426"
     variation       4296..4300
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1255966472"
     variation       4301
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2969941"
     variation       4302
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:71484458"
     variation       4306
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1276775791"
     variation       4308
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:193249911"
     variation       4309..4315
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="aga"
                     /replace="agagaga"
                     /db_xref="dbSNP:1291114280"
     variation       4312
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445219567"
     variation       4313..4317
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:999742524"
     variation       4315
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034929521"
     variation       4322
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490267055"
     variation       4323
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:529943168"
     variation       4326
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772253660"
     variation       4327..4328
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1029518240"
     variation       4340
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549443325"
     variation       4341
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567675904"
     variation       4343
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141487300"
     variation       4349
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325994791"
     variation       4354
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984847749"
     variation       4355
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009228262"
     variation       4357
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565201438"
     variation       4358
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318993552"
     variation       4380
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185330509"
     variation       4381
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298406512"
     variation       4382
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147487820"
     variation       4387
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374201234"
     variation       4388
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476576903"
     variation       4391
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302986712"
     variation       4394..4397
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1161897835"
     variation       4394
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190400599"
     variation       4401
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454103970"
     variation       4405
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879070538"
     variation       4409
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397729432"
     variation       4411
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968170081"
     variation       4413
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761201097"
     variation       4418
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374533576"
     variation       4429
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162612006"
     variation       4431
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303164597"
     variation       4436
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414432208"
     variation       4437
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472306438"
     variation       4439
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922072658"
     variation       4441
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539246596"
     variation       4458..4463
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="tt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1462686730"
     variation       4464
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1236616211"
     variation       4467
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879722165"
     variation       4472
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481175077"
     variation       4473
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253381884"
     variation       4478..4481
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1243068248"
     variation       4478
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565201511"
     variation       4479
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321702251"
     variation       4481
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958817753"
     variation       4486..4489
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="caac"
                     /db_xref="dbSNP:991321061"
     variation       4488
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988108725"
     variation       4489
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190181991"
     variation       4490
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:554066922"
     variation       4500..4504
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:924285475"
     variation       4512
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358921693"
     variation       4517
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036328776"
     variation       4521
                     /gene="ZDHHC5"
                     /gene_synonym="DHHC5; ZNF375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572739456"
ORIGIN      
ctggcgcccagccgccgccccttccgcccccggccctgcgccctcgggctctgcggtccccgcagcccgctctctcaacctcggtgggcctggccgccgtggattccttcttttcggtttcagcggtcgtcagccctgccccaacgggtgagacacagtaacctggttgaactctgcatctggaaagctgaagactgaagaaagataagagacattgactagtctggaaacagggacatctttggaacttcgttttcatccacagtaaacttttgaagtgtcatcaattggaattgatttcttcatcttattctgcctattgggaagaacatggcttcaaggattttaagtttccctttagttttacatgaactttgtaggaaacagagcccttaaagggcttgggaataacaagaagagattgaagacagagaagcttgccctgttttccttgccccttcaaagaaaaggatttacagctcaaacttagaacagctgttgtccagctttagccatcaagagagaaataaattaaaccaccattgccagactacaagccctggtgaagtcagggtgtgggagtggtggcattgagaagactacctaaaagagacaaagactgcagtaaacaaagctcctctttaaagttggaaggggcctcaggttccttcttggattgaaatagaaatagaaacacagggcacacctcttttaggtgcagctcacattttatggaactgtagtcgtggaggtactatagtatctcagaagaatttttctttgcccaaagtttttttgccataccctgatattctctccttcttttgaagacctgcctccatccatgagctgtatcttgatctgtctgactgtccatgttttccacctgcaaccatttgcatgtgtacagcctactgtttgtctccagtttttaaactgtacaagttgtgtttcttaatcttcccttctgccttgttctggggaggtggttattcatcatttggaatcacctttccccctcccatgtgctttccttcatttgagatcttttgacctttggctttatttgggagggggaagggtgataaagttttctgtttccctggttttcttttgtactcctctctgttgcttccctcctcccattttcttgtctgttctgccgctgtgtgggcctgggctatgcggcagggcagatttcccatcagagctccaacatgcccgcagagtctggaaagagattcaaacccagcaagtatgtcccggtctctgcagccgccatcttcctagtgggagctacgacactcttctttgcctttacgtgtccaggactaagcctgtatgtgtcacctgcagtgcccatctacaatgcaattatgtttctctttgtgttggccaacttcagcatggccaccttcatggacccagggattttccctcgagctgaggaggatgaggacaaggaagatgatttccgagctcccctttacaaaacagtggagataaagggcatccaggtgcgcatgaaatggtgtgccacctgccgcttttaccgtccccctcgatgttcccactgcagtgtctgtgacaactgtgtggaggaatttgatcatcactgcccctgggtgaataactgtattggtcgccggaactaccgttattttttccttttcctcctttccctgacagcccacattatgggtgtgtttggctttggcctcctttatgtcctctaccacatagaggaactctcaggggtccgcacggctgtcacaatggcagtaatgtgtgtggctggcttattcttcatccctgtagctggcctcacgggatttcacgtggttctggtggccaggggacgcacaaccaatgaacaggttacgggtaaattccggggaggtgtgaaccccttcaccaatggctgctgtaacaatgtcagccgtgttctctgcagttctccagcacccaggtatttggggagaccaaagaaagagaagacaattgtaatcagacctcccttccttcgaccagaagtttcagatgggcagataactgtgaagatcatggataatggcatccagggagagctgaggagaacaaagtctaagggaagcctggagataacagagagccagtctgcagatgctgaacctccacctcctcctaagccagacctgagccgttacacagggttgcgaacacacctcggcttggctactaatgaggatagtagcttattggccaaggacagccccccgacacctaccatgtacaagtatcggccgggttacagtagcagcagtacgtcagctgccatgccgcattcctccagcgccaagttgagtcgtggggacagcttgaaggagccaacctcaattgcagagagcagccgtcaccccagctaccgctcagagcccagcttggaaccagagagcttccgttctcctacctttggcaaaagttttcacttcgatccactatccagtggctcacgctcctccagcctcaagtcagcccagggcacaggctttgagctgggccagttgcaatccattcgttcagagggcaccacctccacctcctataagagcctggccaaccagacacgcaatggaagcctatcttatgacagcttgctcacaccttcagacagccctgattttgagtcagtgcaggcagggcctgagccagacccacctttaggctatacctctcccttcctgtcagccaggctggcccagcaacgggaagctgagaggcacccacgtttggtgccaactggcccaacacaccgagagccctcaccagtccgttacgacaatctgtcgcgccacattgtggcctctctccaggaacgagagaagttgctgcgccagtcacccccactcccgggccgtgaggaagaaccaggcttgggggactcaggcattcagtcaacaccaggctcgggccatgcccctcgtactagttcctcctcagatgattcaaagagatcacctttgggcaagactccactgggacgcccagctgtcccccgttttggcaagccagatgggctaaggggccggggagtagggtcccctgaaccaggcccaacagccccatacctgggccgatcgatgtcttacagcagccaaaaagcccaacctggtgtctctgagacagaagaagtggccttgcagccattactgacacccaaagatgaagtacagctgaagaccacctacagcaaatccaacgggcagcccaagagcttaggctcagcctcccctggcccaggccagccacctctcagtagccccacgaggggaggagtcaagaaggtgtcaggggttggtggtaccacctatgagatttcggtgtgagccttcggcacctcccctccccaacgcctctgcgcctacaccaaagggccccaggtggccaccttccttccctcaaggggctcccctcccgtgcatggacattttttaaaccaccgattccaagaggatgaggagtgttttctaaaatgcagtaggcttggggagtcggagagttggggccctgagactggggtagcaacccccccttttatcttttaagaccttcccttccttgatccctggaccagactcagtggacatttgtgcaattgctcgccctggagggaaccagatcatttttaaaccagaaataattttttttattattgttacggattctatttttttcctcttctgcgttaccaggtgtgtgtgtacatataatatatatatatatatattataaatatcaaagaaattatatatctatcctgggatgggaaaatgagggagggatacatatacggagggggatcttactcttcccattcctcagaccagcaggaaaagaggggagacgtcagtctttttcctgtggttccctctcatttgtcccagttactaactacggaaatagcatcctctgctggtgctaagtgtgattaggaagaagcctggggagaggtgagtctggaattttggtcacaagagggaaggacttggagaggagaattagttttctaggctcattggcatttagtttccctaggaaaggggtcaaaacttcaagacactggtggtggtgggagatcaggaaaataacttggcctagctcaaacaatattggataatcccctccttgggggagagggattagagtgtgctcctactggccccttggagcctcccctagcttacacagttaacttgattttaaaatccaaggccaggagagaagaatccaaaaagcaatatttttcatcacatgccaaaaacgggggatagagagaaggagtggcaggcctaggcccctccgattgtcccttgggggttacccctcagcccacctcactatggtgctgggtagaggggatacctgggttctaacctctaaataggggagatcccagcctccacaaagaggcccttttattttttattctgattagccattttaaaccaacgaggaataaaaagaaatcctgatctaaccagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]