GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 10:04:29, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_011537574            4012 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens dihydropyrimidinase like 3 (DPYSL3),
            transcript variant X1, mRNA.
ACCESSION   XM_011537574
VERSION     XM_011537574.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000005.10) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 26, 2018 this sequence version replaced XM_011537574.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4012
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
     gene            1..4012
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="dihydropyrimidinase like 3; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 369
                     ESTs, 137 long SRA reads, 19 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 46 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:1809"
                     /db_xref="HGNC:HGNC:3015"
                     /db_xref="MIM:601168"
     variation       2
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996520299"
     variation       3
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461443514"
     variation       8
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575494280"
     variation       10
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373627317"
     variation       12
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397536522"
     variation       14
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359328564"
     variation       17
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1431020417"
     variation       19
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561794493"
     variation       20
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259221690"
     variation       23
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181801817"
     variation       31
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475292756"
     variation       45
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189110235"
     variation       46
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427974750"
     variation       53
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199717154"
     variation       66
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160764194"
     variation       71
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408866513"
     variation       73
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490726338"
     variation       77
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296370134"
     variation       79
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377520018"
     variation       87
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188447309"
     variation       91
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:934760439"
     variation       94
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241160259"
     variation       95
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280090956"
     variation       96
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1237331345"
     variation       96
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553594908"
     variation       97..107
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aaaaaaaaa"
                     /replace="aaaaaaaaaa"
                     /replace="aaaaaaaaaaa"
                     /replace="aaaaaaaaaaaa"
                     /db_xref="dbSNP:367709275"
     variation       97
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281770321"
     variation       98
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485827349"
     variation       103
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016551448"
     variation       106
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320089542"
     variation       107..108
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1396967364"
     variation       107
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1441023564"
     variation       108
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1006012999"
     variation       111..125
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aac"
                     /replace="aacccgggcgtgaac"
                     /db_xref="dbSNP:1231687205"
     variation       121
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435618186"
     variation       127
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322931136"
     variation       128
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1173226377"
     variation       131
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283929372"
     variation       134
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225617508"
     variation       137
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348808474"
     variation       141..147
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="tgtgcgt"
                     /db_xref="dbSNP:1468116616"
     variation       141
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328414654"
     variation       143
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390645668"
     variation       145
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396941704"
     variation       147
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1444460159"
     variation       147
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868210273"
     variation       148..154
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:1047149304"
     variation       148
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886239418"
     variation       150
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1404758887"
     variation       151
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566653640"
     variation       153
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176456888"
     variation       154
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553288411"
     variation       155
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924718664"
     variation       157
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193045164"
     variation       159
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561794422"
     variation       160
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540144384"
     variation       161
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947554318"
     variation       165
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253023462"
     variation       167
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199247825"
     variation       168
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464034064"
     variation       169
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327812347"
     variation       170
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371576125"
     variation       172
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1439559325"
     variation       173
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461231530"
     variation       174..177
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1205707926"
     variation       176
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263861502"
     variation       180
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227704399"
     variation       184
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327130903"
     variation       186
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994190005"
     variation       192
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395100845"
     variation       200..207
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gccgc"
                     /replace="gccgccgc"
                     /replace="gccgccgccgc"
                     /db_xref="dbSNP:1430587831"
     variation       202
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240011574"
     variation       205
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570557336"
     variation       206
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336143995"
     variation       207
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1308795389"
     variation       209..210
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:906552429"
     variation       211
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1422715744"
     variation       212
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550640815"
     variation       213
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166774954"
     variation       214
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395127308"
     variation       215
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460801683"
     variation       217..231
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ggaggggggcggagg"
                     /replace="ggaggggggcggaggggggcggagg"
                     /db_xref="dbSNP:1486875877"
     variation       217
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948336175"
     variation       218
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470706024"
     variation       220
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916833708"
     variation       221
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868662576"
     variation       222
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1480331142"
     variation       223..244
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gggcggaggcgg"
                     /replace="gggcggaggcgggcggaggcgg"
                     /replace="gggcggaggcgggcggaggcgggcggaggcgg"
                     /db_xref="dbSNP:983175559"
     variation       223
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924076557"
     variation       224
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336185414"
     variation       225
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244693173"
     variation       226
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977853911"
     variation       232
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561794353"
     variation       233
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205737855"
     variation       237
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182082506"
     variation       240..249
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ggcggcggcg"
                     /replace="ggcggcggcggcggcg"
                     /db_xref="dbSNP:974433077"
     variation       241..253
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gcggcggcgcggc"
                     /replace="gcggcggcgcggcggcgcggc"
                     /db_xref="dbSNP:1185960740"
     variation       243
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183769961"
     variation       244
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="ggcggaggctg"
                     /db_xref="dbSNP:1554115354"
     variation       250
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1162577917"
     variation       254
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358246391"
     variation       255
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964691668"
     variation       259
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242920541"
     variation       264
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283583356"
     variation       267
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356466160"
     variation       268
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205951329"
     variation       269
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311235049"
     variation       271
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319206226"
     variation       277
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1239861821"
     variation       279
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285322231"
     variation       281
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353052184"
     variation       282..285
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1258026616"
     variation       282
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016144859"
     variation       285
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243547123"
     variation       289
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482820353"
     variation       290..291
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1381758097"
     variation       292
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252584200"
     variation       293
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1419543164"
     variation       294
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568282671"
     variation       303
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923117377"
     variation       307
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950574003"
     variation       308
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561794300"
     variation       309
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975913037"
     variation       311
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961798743"
     variation       312
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907612116"
     variation       315
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192761790"
     variation       316
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780069433"
     variation       317
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371812308"
     variation       319..323
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="agcag"
                     /replace="agcagcag"
                     /db_xref="dbSNP:745353597"
     variation       320
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758969737"
     variation       321
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367940618"
     variation       322..329
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="agaag"
                     /replace="agaagaag"
                     /replace="agaagaagaag"
                     /db_xref="dbSNP:778474557"
     variation       322
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895103442"
     variation       324
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281352268"
     variation       327
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779343461"
     variation       328
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757632182"
     variation       332
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460363087"
     variation       333
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265148361"
     variation       334
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374875662"
     variation       336
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480958651"
     variation       337
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528736381"
     variation       338
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042566506"
     variation       340
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:910767025"
     variation       341
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002870679"
     variation       345
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763875948"
     variation       346
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370710925"
     variation       347
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216136869"
     variation       348
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424034362"
     variation       351
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365706576"
     variation       357
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412339624"
     variation       360
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974865439"
     variation       361
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943063693"
     variation       362
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554115339"
     variation       364
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335810378"
     variation       365
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:758927120"
     variation       367
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766876733"
     variation       369
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302935274"
     variation       373
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759520414"
     variation       375
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291205451"
     variation       376
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013738830"
     variation       385
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201601413"
     variation       394
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137909376"
     variation       397
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391232897"
     variation       400
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443209367"
     variation       405
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984697504"
     variation       406
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379773556"
     variation       409
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349696170"
     variation       413
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211523706"
     variation       419
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279506605"
     variation       424
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484443328"
     variation       429..430
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35739037"
     variation       433
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310151906"
     variation       438
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909083184"
     variation       453
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183431791"
     variation       458
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469332018"
     variation       472
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175079659"
     variation       473
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234869961"
     variation       474
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:983070898"
     variation       483
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174887416"
     variation       499
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375336733"
     variation       504
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372581121"
     CDS             507..2207
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /codon_start=1
                     /product="dihydropyrimidinase-related protein 3 isoform
                     X1"
                     /protein_id="XP_011535876.1"
                     /db_xref="GeneID:1809"
                     /db_xref="HGNC:HGNC:3015"
                     /db_xref="MIM:601168"
                     /translation="
MPISIYETQSDRLLIKGGRIVNDDQSFYADIYMEDGLIKQIGDNLIVPGGVKTIEANGKMVIPGGIDVHTHFQMPYKGMTTVDDFFQGTKAALAGGTTMIIDHVVPEPESSLTEAYEKWREWADGKSCCDYALHVDITHWNDSVKQEVQNLIKDKGVNSFMVYMAYKDLYQVSNTELYEIFTCLGELGAIAQVHAENGDIIAQEQTRMLEMGITGPEGHVLSRPEELEAEAVFRAITIASQTNCPLYVTKVMSKSAADLISQARKKGNVVFGEPITASLGIDGTHYWSKNWAKAAAFVTSPPLSPDPTTPDYINSLLASGDLQLSGSAHCTFSTAQKAIGKDNFTAIPEGTNGVEERMSVIWDKAVATGKMDENQFVAVTSTNAAKIFNLYPRKGRISVGSDSDLVIWDPDAVKIVSAKNHQSAAEYNIFEGMELRGAPLVVICQGKIMLEDGNLHVTQGAGRFIPCSPFSDYVYKRIKARRKMADLHAVPRGMYDGPVFDLTTTPKGGTPAGSARGSPTRPNPPVRNLHQSGFSLSGTQVDEGVRSASKRIVAPPGGRSNITSLS"
     misc_feature    528..1895
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="dihydroorotase; Validated; Region: PRK09060"
                     /db_xref="CDD:181632"
     misc_feature    543..1907
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="D-hydantoinase; Region: D-hydantoinase; TIGR02033"
                     /db_xref="CDD:273937"
     misc_feature    order(576..581,585..587,624..629,1032..1034,1095..1097,
                     1104..1106,1113..1115,1182..1184,1194..1196,1206..1208,
                     1215..1217,1296..1301,1305..1310,1662..1664,1677..1679,
                     1692..1694)
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="tetramer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238639"
     misc_feature    order(711..713,717..719,987..989,1086..1088,1254..1256,
                     1488..1490)
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="active site"
                     /db_xref="CDD:238639"
     variation       508
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1330999485"
     variation       508
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:918677999"
     variation       509
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761385584"
     variation       513
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445375058"
     variation       519
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543770119"
     variation       520
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1396839411"
     variation       524
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234743430"
     variation       525
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302632789"
     variation       529
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345614485"
     variation       532
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754669018"
     variation       540
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771972753"
     variation       541
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374440794"
     variation       549
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265792687"
     variation       551
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933190174"
     variation       554
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778230955"
     variation       556
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333906044"
     variation       560
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371030253"
     variation       561
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409839247"
     variation       566
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752329261"
     variation       567
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376535312"
     variation       571
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426127055"
     variation       574
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393394009"
     variation       580
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164185028"
     variation       582
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754503646"
     variation       587
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031236169"
     variation       592
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751057179"
     variation       594
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184469866"
     variation       595
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000205679"
     variation       603
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954682768"
     variation       605
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423928952"
     variation       626
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748508790"
     variation       628
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260778682"
     variation       635
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251779877"
     variation       654
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177783408"
     variation       655
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429252383"
     variation       659
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467727635"
     variation       660
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1271087572"
     variation       664
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376419607"
     variation       665
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345295881"
     variation       666
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754627549"
     variation       667
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958023861"
     variation       668
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032260219"
     variation       671
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173022930"
     variation       672
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751063562"
     variation       675
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322955406"
     variation       676
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007434012"
     variation       683
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405913183"
     variation       690
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779569209"
     variation       693
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758346627"
     variation       697
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750296589"
     variation       699
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373398234"
     variation       704
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761657413"
     variation       705
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369477048"
     variation       709
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051623683"
     variation       712
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767677729"
     variation       716
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241130589"
     variation       720
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759750712"
     variation       721
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:17853869"
     variation       722
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321385615"
     variation       727
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216057747"
     variation       730
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774304174"
     variation       731
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758536186"
     variation       733
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763117789"
     variation       738
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773912873"
     variation       745
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300277747"
     variation       756
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770401823"
     variation       762
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766199489"
     variation       774
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781579811"
     variation       776
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450773209"
     variation       777
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198126870"
     variation       778
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768216009"
     variation       779
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201521252"
     variation       780
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778829032"
     variation       782
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17106709"
     variation       788
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169000689"
     variation       790
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409813415"
     variation       797
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377294346"
     variation       803
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383120272"
     variation       806
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754994345"
     variation       807
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183579974"
     variation       815
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374737256"
     variation       819
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139341814"
     variation       822
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775183154"
     variation       830
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771694171"
     variation       836
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745426369"
     variation       838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251865507"
     variation       840
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778358403"
     variation       842
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918367287"
     variation       845
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371548122"
     variation       848
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489710048"
     variation       850
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757195721"
     variation       853
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572434542"
     variation       855
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367769724"
     variation       860
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284121634"
     variation       867
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777564671"
     variation       875
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331375127"
     variation       881
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558974365"
     variation       885
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755992859"
     variation       887
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404638487"
     variation       891
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1036917761"
     variation       896
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458574312"
     variation       899
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752411530"
     variation       902
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295087682"
     variation       906
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766746019"
     variation       907
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1344571206"
     variation       908
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940886605"
     variation       911
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201787615"
     variation       912
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973954644"
     variation       913
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750552836"
     variation       914
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765351592"
     variation       915
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147541241"
     variation       919
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193306229"
     variation       920
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777263653"
     variation       924
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399366118"
     variation       929
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241871008"
     variation       930
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764498265"
     variation       935
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761152983"
     variation       936
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116679689"
     variation       946
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289392855"
     variation       948
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771747440"
     variation       949
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745478173"
     variation       951
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442821716"
     variation       953
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303628898"
     variation       956
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220006391"
     variation       957
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773851486"
     variation       965
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295108492"
     variation       972
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770538365"
     variation       973
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204309430"
     variation       974
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774059481"
     variation       975
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770462148"
     variation       977
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302915459"
     variation       980
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461179400"
     variation       988
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368258730"
     variation       994
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561778293"
     variation       995
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544817415"
     variation       997
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561778288"
     variation       1005
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772550085"
     variation       1006
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1391142497"
     variation       1014
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214623338"
     variation       1015
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575844670"
     variation       1017
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422565988"
     variation       1018
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056679957"
     variation       1021
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748032395"
     variation       1022
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556065111"
     variation       1027
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1561778266"
     variation       1028
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768629396"
     variation       1039
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1326526812"
     variation       1044
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772784218"
     variation       1046
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378259870"
     variation       1051
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228696631"
     variation       1052
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769127728"
     variation       1053
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323324495"
     variation       1054
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377270433"
     variation       1056
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1379907448"
     variation       1057
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433481612"
     variation       1062
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931715826"
     variation       1063
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:921701958"
     variation       1066
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392889178"
     variation       1070
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776774448"
     variation       1072
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768682357"
     variation       1074
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213722276"
     variation       1076
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746847113"
     variation       1077
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775095992"
     variation       1078
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473049327"
     variation       1081
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1561777845"
     variation       1087
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177868696"
     variation       1091
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377236546"
     variation       1096
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771212935"
     variation       1097
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749400341"
     variation       1099
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370048196"
     variation       1104
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208097914"
     variation       1107
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463489765"
     variation       1113
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756257899"
     variation       1124
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35891125"
     variation       1125
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368879178"
     variation       1126
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755481306"
     variation       1127
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057084923"
     variation       1128
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747416841"
     variation       1130
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456642358"
     variation       1131
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937429406"
     variation       1140
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363687315"
     variation       1142
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34332356"
     variation       1147
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201487610"
     variation       1148
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750768155"
     variation       1151
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765028918"
     variation       1163
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201569659"
     variation       1164
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367968514"
     variation       1171
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763626428"
     variation       1179
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913119486"
     variation       1183
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290851841"
     variation       1190
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410556390"
     variation       1191
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391849743"
     variation       1197
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179645447"
     variation       1206
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474166214"
     variation       1207
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751363047"
     variation       1208
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370308670"
     variation       1213
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762723911"
     variation       1216
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346618241"
     variation       1218
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231659274"
     variation       1225
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276087650"
     variation       1226
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480659678"
     variation       1229
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1451554601"
     variation       1230
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288298071"
     variation       1231
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009286976"
     variation       1238
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335600922"
     variation       1239
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194770990"
     variation       1246
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747180872"
     variation       1247
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768834528"
     variation       1248
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377142026"
     variation       1251
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298556773"
     variation       1259
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435445209"
     variation       1261
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347872582"
     variation       1263
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775590493"
     variation       1270
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031989147"
     variation       1278
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772484841"
     variation       1279
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1262311328"
     variation       1280
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138020761"
     variation       1281
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156238918"
     variation       1283
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473378891"
     variation       1289
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172031703"
     variation       1311
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561773057"
     variation       1312
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767573218"
     variation       1331
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455095183"
     variation       1333
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759671041"
     variation       1337
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314280262"
     variation       1343
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374362949"
     variation       1344
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749696414"
     variation       1351
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261375806"
     variation       1364
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773674068"
     variation       1369
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310597531"
     variation       1373
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280493973"
     variation       1380
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234695140"
     variation       1381
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769338348"
     variation       1382
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747779189"
     variation       1387
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437159047"
     variation       1388
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200777055"
     variation       1389
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754584484"
     variation       1393
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269891882"
     variation       1394
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337525087"
     variation       1398
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464233292"
     variation       1400
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372399159"
     variation       1406
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183360676"
     variation       1410
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035665716"
     variation       1412
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750247835"
     variation       1415
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389920699"
     variation       1419
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765013840"
     variation       1420
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219921836"
     variation       1422
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451877544"
     variation       1428
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756302276"
     variation       1430
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753017382"
     variation       1431
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482414232"
     variation       1433
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428949601"
     variation       1435
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767626566"
     variation       1436
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746870672"
     variation       1444
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370991512"
     variation       1447
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539740774"
     variation       1449
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941054021"
     variation       1453
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370077188"
     variation       1460
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767026872"
     variation       1463
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751007269"
     variation       1464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765632189"
     variation       1467
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397615121"
     variation       1478
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762286701"
     variation       1479
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456832027"
     variation       1480
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455505351"
     variation       1489
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776812299"
     variation       1496
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201019011"
     variation       1504
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406378805"
     variation       1505
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760252867"
     variation       1507
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468789441"
     variation       1509
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409969847"
     variation       1511
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774990938"
     variation       1521
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368254542"
     variation       1522
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771625097"
     variation       1535
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208060302"
     variation       1537
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76516681"
     variation       1539
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200957398"
     variation       1541
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745361456"
     variation       1542
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273280445"
     variation       1547
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444962248"
     variation       1553
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778946047"
     variation       1556
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770728163"
     variation       1558
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749143796"
     variation       1561
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777366989"
     variation       1562
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336787531"
     variation       1568
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755267708"
     variation       1569
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301015383"
     variation       1576
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385600033"
     variation       1586
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10515587"
     variation       1587
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370311772"
     variation       1588
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924697047"
     variation       1589
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200870327"
     variation       1593
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324562094"
     variation       1598
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386504346"
     variation       1599
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046190056"
     variation       1604
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200136595"
     variation       1605
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745990406"
     variation       1609
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778792059"
     variation       1610
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253597404"
     variation       1611
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212539373"
     variation       1621
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350565597"
     variation       1622
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757796024"
     variation       1623
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754356799"
     variation       1624
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764576617"
     variation       1629
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556229292"
     variation       1630
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160512073"
     variation       1631
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272022180"
     variation       1632
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:878891490"
     variation       1634
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1228190683"
     variation       1637
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440577827"
     variation       1639
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339911001"
     variation       1642
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756509306"
     variation       1651
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1252571387"
     variation       1652
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753034401"
     variation       1653
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245713924"
     variation       1655
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767191885"
     variation       1656
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759046215"
     variation       1665
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773930325"
     variation       1673
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201914504"
     variation       1675
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421514555"
     variation       1676
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762521696"
     variation       1682
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190292517"
     variation       1684
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369407412"
     variation       1685
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561771381"
     variation       1688..1690
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1561771372"
     variation       1688
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472202284"
     variation       1691
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773322580"
     variation       1699
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189699404"
     variation       1700
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485755880"
     variation       1701
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391143057"
     variation       1702
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561771346"
     variation       1703
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35381274"
     variation       1706
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747981160"
     variation       1708
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776525457"
     variation       1709
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275767374"
     variation       1713
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772341292"
     variation       1715
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375162549"
     variation       1716
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291512141"
     variation       1721
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779181977"
     variation       1722
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757343684"
     variation       1723
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287517973"
     variation       1724
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749330607"
     variation       1725
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356032463"
     variation       1732
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329516939"
     variation       1738
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404684930"
     variation       1740
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994683071"
     variation       1743
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778298980"
     variation       1751
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756560734"
     variation       1752
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372122886"
     variation       1753
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207769671"
     variation       1757
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410715797"
     variation       1758
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265683666"
     variation       1763
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767815118"
     variation       1765
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755401521"
     variation       1774
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755360448"
     variation       1777
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758085369"
     variation       1778
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749955993"
     variation       1780
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764781361"
     variation       1781
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761393367"
     variation       1784
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363908220"
     variation       1802
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753892360"
     variation       1804
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432479692"
     variation       1806
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345370738"
     variation       1811
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1160331180"
     variation       1812
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434534045"
     variation       1813
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188735247"
     variation       1814
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760432417"
     variation       1817
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296097083"
     variation       1818
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2304044"
     variation       1821
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771087651"
     variation       1825
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445805600"
     variation       1826
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028326734"
     variation       1828
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202141552"
     variation       1830
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486990010"
     variation       1832
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769931944"
     variation       1833
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377603066"
     variation       1838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561770582"
     variation       1853
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748199099"
     variation       1856
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300256324"
     variation       1861
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781599179"
     variation       1868
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769157829"
     variation       1869
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747367486"
     variation       1871
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780400795"
     variation       1874
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370095443"
     variation       1875
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147214429"
     variation       1886
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370899306"
     variation       1887
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004810629"
     variation       1888
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489478190"
     variation       1893
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753362629"
     variation       1894
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377459296"
     variation       1902
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252503783"
     variation       1903
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532476363"
     variation       1908
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752450859"
     variation       1912
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373475070"
     variation       1913
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767405700"
     variation       1919
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117731508"
     variation       1920
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200874080"
     variation       1923
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776734034"
     variation       1924
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369865347"
     variation       1928
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178557899"
     variation       1929
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461681252"
     variation       1930
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1324612396"
     variation       1931
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391725848"
     variation       1935
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769049808"
     variation       1936
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474309300"
     variation       1938
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:965952237"
     variation       1947
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747491194"
     variation       1948
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775844954"
     variation       1951
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293651290"
     variation       1954
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561770459"
     variation       1960
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374998534"
     variation       1961
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:962598779"
     variation       1962
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393657269"
     variation       1963
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381394072"
     variation       1964
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200587767"
     variation       1966
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1296604219"
     variation       1967
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367672335"
     variation       1972
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866804037"
     variation       1973
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448805202"
     variation       1974
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776105614"
     variation       1981
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376867895"
     variation       1986
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166003966"
     variation       1987
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448991070"
     variation       1988
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453318131"
     variation       1991
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361855113"
     variation       1992
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772681423"
     variation       1994
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746254120"
     variation       2007
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774814276"
     variation       2010
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200381159"
     variation       2011
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749030462"
     variation       2012
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237447464"
     variation       2020
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990783323"
     variation       2021
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777289428"
     variation       2022
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755693993"
     variation       2024
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348023166"
     variation       2028
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561769309"
     variation       2033
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035469319"
     variation       2035
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259355479"
     variation       2036
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241576766"
     variation       2039
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540998273"
     variation       2040
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781130845"
     variation       2043
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235306105"
     variation       2044
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1803521"
     variation       2052
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751361322"
     variation       2053
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766107448"
     variation       2056
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754155618"
     variation       2058
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181060345"
     variation       2059
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426207967"
     variation       2067
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902623921"
     variation       2068
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383006271"
     variation       2071
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372328515"
     variation       2072
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760857578"
     variation       2074
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394235672"
     variation       2080
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415314922"
     variation       2084
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200227942"
     variation       2089
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367549900"
     variation       2096
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768165929"
     variation       2099
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983506607"
     variation       2101
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752895926"
     variation       2102
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199502989"
     variation       2104
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035491375"
     variation       2106
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207358713"
     variation       2121
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542333524"
     variation       2122
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025206541"
     variation       2123
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3792837"
     variation       2124
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17853868"
     variation       2131
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768220433"
     variation       2135..2139
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1238404625"
     variation       2135
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374056960"
     variation       2138
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780014551"
     variation       2139
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771854528"
     variation       2142
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998856637"
     variation       2143
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773944258"
     variation       2152
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778502005"
     variation       2155
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334226797"
     variation       2156
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936628864"
     variation       2158
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756369537"
     variation       2162
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200584034"
     variation       2163
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755161394"
     variation       2165
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751645128"
     variation       2167
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766945584"
     variation       2168
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763302616"
     variation       2171
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933380784"
     variation       2174
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259727592"
     variation       2177
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376767463"
     variation       2178
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375392700"
     variation       2182
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762162860"
     variation       2183
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577467748"
     variation       2185
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358675564"
     variation       2193
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763713401"
     variation       2194
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760199898"
     variation       2195
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774822283"
     variation       2206..2213
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aagc"
                     /replace="aagcaagc"
                     /db_xref="dbSNP:762706222"
     variation       2208
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051649933"
     variation       2210
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414994738"
     variation       2213
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158299773"
     variation       2221..2223
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:775308643"
     variation       2224
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480386473"
     variation       2227
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:764830950"
     variation       2227
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772047096"
     variation       2228
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174962601"
     variation       2229
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561768358"
     variation       2231
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:940846847"
     variation       2233
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462775350"
     variation       2243..2247
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:759160130"
     variation       2253
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167714467"
     variation       2256
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745731115"
     variation       2258
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407066533"
     variation       2272
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921121964"
     variation       2273
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909423927"
     variation       2274
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039611279"
     variation       2288
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308025835"
     variation       2289
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1443645348"
     variation       2291
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256464246"
     variation       2292
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985034235"
     variation       2293
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959015596"
     variation       2303
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033746347"
     variation       2305
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487522078"
     variation       2308
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980482519"
     variation       2312
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970856736"
     variation       2313
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1024736425"
     variation       2323
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489617765"
     variation       2324
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218035380"
     variation       2328
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429637609"
     variation       2337
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192917160"
     variation       2340
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356435240"
     variation       2345
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009318325"
     variation       2350
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164494774"
     variation       2356
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929679125"
     variation       2360
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282887304"
     variation       2376
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892299541"
     variation       2377
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927729121"
     variation       2385
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342090245"
     variation       2406
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032167298"
     variation       2414
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982290584"
     variation       2416
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000722123"
     variation       2419
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190962577"
     variation       2421
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218085013"
     variation       2426
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023565823"
     variation       2427
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486472720"
     variation       2430..2435
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1398368710"
     variation       2433
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991675818"
     variation       2435
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446782358"
     variation       2448
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767038754"
     variation       2451
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957620062"
     variation       2454
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384781144"
     variation       2460
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889061181"
     variation       2464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1297323909"
     variation       2464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140806749"
     variation       2468
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575533132"
     variation       2469
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555761451"
     variation       2471
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768344292"
     variation       2472
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408242708"
     variation       2479
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029728896"
     variation       2488
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901890279"
     variation       2489
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472183520"
     variation       2497
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1380122409"
     variation       2502
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535952012"
     variation       2503
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940789539"
     variation       2505
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561768121"
     variation       2506
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315853932"
     variation       2509
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998707089"
     variation       2513
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213074099"
     variation       2517
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899635801"
     variation       2523
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1463060122"
     variation       2525
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189263714"
     variation       2529
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746269998"
     variation       2533
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460137713"
     variation       2539
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262977998"
     variation       2541
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909368057"
     variation       2546
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418534197"
     variation       2548
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186317891"
     variation       2549
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180940372"
     variation       2552
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403700684"
     variation       2559
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937567201"
     variation       2567
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1298355371"
     variation       2568
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927583338"
     variation       2572
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547175352"
     variation       2573
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980813562"
     variation       2577
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224721850"
     variation       2580
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970424807"
     variation       2587
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917624968"
     variation       2591
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441083568"
     variation       2593
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207099240"
     variation       2594
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233612742"
     variation       2595
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927647842"
     variation       2598
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175554664"
     variation       2604
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146411440"
     variation       2608
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357210930"
     variation       2624
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947812458"
     variation       2625
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175669601"
     variation       2631
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561768035"
     variation       2633
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427153696"
     variation       2634
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411401340"
     variation       2635
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170894655"
     variation       2637
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761275309"
     variation       2643
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:956481807"
     variation       2644
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439656054"
     variation       2647
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217081129"
     variation       2660
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345646513"
     variation       2666
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1340099091"
     variation       2667
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032115891"
     variation       2669
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000671622"
     variation       2674
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406053373"
     variation       2676
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283156185"
     variation       2684
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753211757"
     variation       2687
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274234073"
     variation       2693
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561767997"
     variation       2694
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400421688"
     variation       2706
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203346237"
     variation       2707
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991625142"
     variation       2708
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143982609"
     variation       2711
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198821247"
     variation       2712
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953387351"
     variation       2714
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028917588"
     variation       2715
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1186881502"
     variation       2721
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321524682"
     variation       2723
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404686292"
     variation       2724
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997886096"
     variation       2728
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165123514"
     variation       2734
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901840873"
     variation       2736
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036392715"
     variation       2737
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551008324"
     variation       2740
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300755414"
     variation       2742
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531272775"
     variation       2764
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433577841"
     variation       2769
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3749721"
     variation       2776
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139117381"
     variation       2777
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226689706"
     variation       2779..2780
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35067518"
     variation       2779
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:899920672"
     variation       2780
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221756308"
     variation       2782
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927499608"
     variation       2784
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448648298"
     variation       2785
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423994828"
     variation       2788
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018088966"
     variation       2795
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241270186"
     variation       2800
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528911748"
     variation       2803
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185219181"
     variation       2807
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385405645"
     variation       2810
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950386150"
     variation       2813
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1161121462"
     variation       2814
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049161"
     variation       2815
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:987788526"
     variation       2820
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345141129"
     variation       2821
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956431723"
     variation       2823
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771376088"
     variation       2831
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777051046"
     variation       2834
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929890120"
     variation       2835
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:925046201"
     variation       2836..2838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1383790999"
     variation       2837
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1803520"
     variation       2838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373357109"
     variation       2846
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953240184"
     variation       2847
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78922742"
     variation       2849
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577431475"
     variation       2856..2860
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="aatgc"
                     /db_xref="dbSNP:1283409307"
     variation       2858
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409981009"
     variation       2860
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188091020"
     variation       2868
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916309156"
     variation       2871
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184807613"
     variation       2872
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151163132"
     variation       2873
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936153475"
     variation       2877
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243592297"
     variation       2878
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272857374"
     variation       2890
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435729731"
     variation       2892
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926152928"
     variation       2897
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014910747"
     variation       2901
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470155242"
     variation       2902
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376062947"
     variation       2906
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1004901172"
     variation       2915..2922
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tctt"
                     /replace="tctttctt"
                     /db_xref="dbSNP:1411787698"
     variation       2916
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157498846"
     variation       2924
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456177251"
     variation       2926
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772280263"
     variation       2948
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1339089024"
     variation       2958
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575046837"
     variation       2974
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407360316"
     variation       2984
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027745037"
     variation       2988
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968052518"
     variation       2989
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337772775"
     variation       2993
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1239782859"
     variation       2998
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747457889"
     variation       3000
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906026210"
     variation       3003
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171018713"
     variation       3006
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977168145"
     variation       3019
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142183802"
     variation       3021
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:555468068"
     variation       3023
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411293422"
     variation       3024
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263498134"
     variation       3035
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10065495"
     variation       3040
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950309942"
     variation       3042
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198539988"
     variation       3049
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252156152"
     variation       3055
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018370712"
     variation       3056
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892064091"
     variation       3059
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005666546"
     variation       3061
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573330599"
     variation       3063
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052020459"
     variation       3064
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935005426"
     variation       3065
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430651447"
     variation       3067
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553528497"
     variation       3069
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171196818"
     variation       3076
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576930831"
     variation       3085
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:994058434"
     variation       3092
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392245953"
     variation       3107
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906450637"
     variation       3108
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177247033"
     variation       3110
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924993885"
     variation       3111
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111296628"
     variation       3116
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540005947"
     variation       3117
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230707485"
     variation       3118
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979201396"
     variation       3119
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758616098"
     variation       3121
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440883320"
     variation       3125
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931757769"
     variation       3130
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:921769363"
     variation       3139
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339640667"
     variation       3144
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194921427"
     variation       3145
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271820982"
     variation       3153
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976339248"
     variation       3157
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965923954"
     variation       3160
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012322404"
     variation       3162
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433116265"
     variation       3169
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181267279"
     variation       3177
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375194510"
     variation       3179
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345369401"
     variation       3188
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305550629"
     variation       3194
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462662726"
     variation       3200
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168157945"
     variation       3202
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368976287"
     variation       3204
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748222574"
     variation       3208
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181832633"
     variation       3210
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190171030"
     variation       3215
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385068527"
     variation       3220
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1561767735"
     variation       3220
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297425513"
     variation       3222
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983413500"
     variation       3229
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952024911"
     variation       3230
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537333317"
     variation       3237
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1443988781"
     variation       3242
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222493263"
     variation       3244
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290482364"
     variation       3252
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001611256"
     variation       3255
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357093385"
     variation       3257
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75613839"
     variation       3258
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977071957"
     variation       3260
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1415409924"
     variation       3268
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024455168"
     variation       3282
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188343580"
     variation       3300
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561767671"
     variation       3302
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1014851467"
     variation       3315
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964374469"
     variation       3316
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548651514"
     variation       3325
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053303249"
     variation       3328
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1456300007"
     variation       3330
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936296920"
     variation       3339
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879111154"
     variation       3346
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381046852"
     variation       3348
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952773040"
     variation       3350
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903521310"
     variation       3351
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043811953"
     variation       3352..3355
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="ggga"
                     /db_xref="dbSNP:1246331238"
     variation       3354
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384534006"
     variation       3357
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76958182"
     variation       3361
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921689407"
     variation       3366..3367
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1262958546"
     variation       3366
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240593626"
     variation       3371
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486482310"
     variation       3372
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560071783"
     variation       3378..3379
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1442845895"
     variation       3387
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246637746"
     variation       3395
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462808671"
     variation       3399
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184481287"
     variation       3408
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025292597"
     variation       3411
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282190886"
     variation       3414
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1012194075"
     variation       3418
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561767611"
     variation       3419
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364239605"
     variation       3420
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75139854"
     variation       3430
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779874606"
     variation       3433
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561767595"
     variation       3440
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408086658"
     variation       3452
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352867213"
     variation       3456..3458
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:560014863"
     variation       3459
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755819037"
     variation       3464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392559250"
     variation       3465
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309827674"
     variation       3469
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907747359"
     variation       3470
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:546271916"
     variation       3472
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:946207165"
     variation       3478
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266589167"
     variation       3481
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326045942"
     variation       3490
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204734556"
     variation       3497
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237062141"
     variation       3499
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115762779"
     variation       3505
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179017648"
     variation       3509
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041683258"
     variation       3510
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472209822"
     variation       3513
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156812272"
     variation       3520
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920590818"
     variation       3525
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942981928"
     variation       3531
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175103467"
     variation       3534
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357068209"
     variation       3538
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463255188"
     variation       3543
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1298230173"
     variation       3546
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561767530"
     variation       3560
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980530559"
     variation       3564
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349382823"
     variation       3566
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407488619"
     variation       3569
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286946375"
     variation       3570
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970140405"
     variation       3574
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347951872"
     variation       3575
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419425816"
     variation       3580
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278436274"
     variation       3584
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1310648930"
     variation       3601
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206946276"
     variation       3603
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275404076"
     variation       3607
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1361765044"
     variation       3609
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161826323"
     variation       3610
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1270880963"
     variation       3620
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403686322"
     variation       3621
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1413147527"
     variation       3623
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182727292"
     variation       3628
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476291900"
     variation       3630
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911184698"
     variation       3631
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191265869"
     variation       3634
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564124459"
     variation       3637
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984127456"
     variation       3638
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261247115"
     variation       3641
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217788162"
     variation       3652..3660
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aaga"
                     /replace="aagataaga"
                     /db_xref="dbSNP:1427196387"
     variation       3656
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931334957"
     variation       3657..3661
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:753606011"
     variation       3661
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1304433605"
     variation       3663
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756774466"
     variation       3670
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1024819888"
     variation       3685
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369757405"
     variation       3689
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274605664"
     variation       3692
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014338047"
     variation       3698
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867237370"
     variation       3705
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577580337"
     variation       3706
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544437600"
     variation       3721
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530676830"
     variation       3722
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000391210"
     variation       3725
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275864822"
     variation       3727
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959286857"
     variation       3728
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452090392"
     variation       3734
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562019808"
     variation       3742
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244945315"
     variation       3743
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043369498"
     variation       3746
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542218190"
     variation       3753
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389094862"
     variation       3758
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409676694"
     variation       3764
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291201879"
     variation       3771
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164920348"
     variation       3776
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1385370335"
     variation       3780
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902228015"
     variation       3789
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323428141"
     variation       3792
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348662553"
     variation       3798
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433247812"
     variation       3800
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765804403"
     variation       3802..3805
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1021107170"
     variation       3815
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573291818"
     variation       3819
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944471309"
     variation       3821
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226535469"
     variation       3823
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866405044"
     variation       3824
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147224404"
     variation       3827
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1170157768"
     variation       3827
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049171"
     variation       3829
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143682341"
     variation       3838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1287569424"
     variation       3839
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448662612"
     variation       3840
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209113175"
     variation       3841
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247248386"
     variation       3845
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047617031"
     variation       3846
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557229342"
     variation       3857
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188281200"
     variation       3861
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237724967"
     variation       3870
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041217453"
     variation       3872
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160956493"
     variation       3875
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537653143"
     variation       3876
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403011920"
     variation       3880
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920522605"
     variation       3889
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980094080"
     variation       3895..3915
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gga"
                     /replace="ggagatagccaaggaacagga"
                     /db_xref="dbSNP:1341309617"
     variation       3897
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1388423116"
     variation       3906
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433393907"
     variation       3914
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754207295"
     variation       3916
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447296810"
     variation       3919
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:890032573"
     variation       3922
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048715299"
     variation       3923
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970468110"
     variation       3925
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228982307"
     variation       3929
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568629561"
     variation       3930
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:554858336"
     variation       3932
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:59026412"
     variation       3934
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326765463"
     variation       3940
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205355088"
     variation       3948
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256343902"
     variation       3953
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535017942"
     variation       3955
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918619694"
     variation       3956
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234165694"
     variation       3959
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566108899"
     variation       3961
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973198525"
     variation       3962..3964
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:775342340"
     variation       3963
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949514923"
     variation       3965..3968
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:917703300"
     variation       3966
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917297411"
     variation       3968
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179032800"
     variation       3971
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414173131"
     variation       3978
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990678010"
     variation       3980
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959233139"
     variation       3987
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992865958"
     variation       3989
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1287592411"
     variation       3995
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348564304"
     variation       3998
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225113125"
     variation       3999
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032219554"
     variation       4006
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198417758"
     variation       4007
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274720451"
ORIGIN      
atgcaaagaggaaaatcaatagggataagagagaagagggaggagtcgcagatcagccattcttgtcttatggggtcccagctggcgcagcaaaagaaaaaaaaaaacaaaacccgggcgtgaacgcgggtggaggagggtgtgcgtgggggggcgggggtgaaagggggaccggggagatttactattgtctctggcagccgccgcgggagcccgggaggggggcggaggcgggcggaggcggcggcgcggccagcgcaccattcactccacctgatctcggggcgctgtgcgctgaggaaggcgcgggcgagccggagcagaagaaggagggagggagccagccgctgcagccaccaccgccaccatgtcctaccaaggcaagaagaacatcccgcggatcacggcaaatgagaaacaaataagaaagaccttggaaaacccagagaaatcgactcctgtattttcagactccttttgctgtgaagtccctctttcatcaacatatgcctatttcaatatacgaaacacagagtgaccgtctccttatcaagggaggcagaatcgtcaatgatgatcagtccttttatgctgatatttacatggaagatggcttaataaaacaaattggagacaatctgattgttcctggaggagtgaagaccattgaagccaatgggaagatggtgatccctggaggcatcgatgtccatactcacttccagatgccatataagggaatgaccacagtagatgacttcttccaagggacaaaggcggccttagcaggtggcaccaccatgatcattgaccatgtggtgcctgagcctgagtccagcctgactgaggcctatgagaaatggagagagtgggctgatgggaagagttgctgtgactatgccctgcatgtggacatcacccactggaatgacagcgtcaagcaggaagtgcagaacctcatcaaggacaaaggggttaactccttcatggtttatatggcttataaggatttgtatcaagtatctaacacagagctctatgagatcttcacctgcctgggagagctgggggccattgctcaagttcatgctgagaatggggatatcattgcccaggagcaaacccgcatgttggaaatggggataactggcccagaaggccatgtactgagcaggccagaagagctggaagctgaggctgtgttccgtgccatcaccattgccagccaaaccaattgccctctctacgtcacaaaggtcatgagcaagagtgcagctgacctcatctcacaagccaggaaaaaaggaaatgtagtctttggtgagcccatcactgccagcctcggcatagatggaacccattattggagcaagaactgggccaaggcggctgcatttgtgacatccccacccctgagccctgacccaactactccggactacatcaactccttgctggccagcggggatctgcagctatctgggagtgcccactgcaccttcagcactgcccagaaagcaattgggaaggacaacttcacagccattcctgagggcaccaatggtgtggaggagcggatgtctgtcatctgggacaaggctgtggccacagggaaaatggacgaaaaccagttcgtggctgtgacaagcacaaacgctgccaagatcttcaacctgtatccccgcaagggaagaatatctgtgggttctgacagcgacctcgtcatctgggatccagatgctgtgaagatcgtctctgccaagaaccaccagtctgcggcagagtacaacatctttgaagggatggagctgcgcggggctcctctggttgtcatctgccagggcaagatcatgctggaagatggcaacctgcacgtgacccagggggctggccgcttcataccctgcagcccgttctccgactatgtctacaagcgcattaaagcacggaggaagatggcagacctgcatgccgtcccaaggggcatgtacgatgggcctgtgtttgacctgaccaccacccccaaaggtggcacccccgcaggctctgctcggggctctcctactcggccgaacccacctgtgaggaatcttcatcagtcgggatttagcctgtcaggcacccaagtggatgagggggttcgctcagccagcaagcgcatcgtggcgcccccaggcggccgttctaatatcacatctctgagttaagcaagccttcctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtacaccgatatttaagaaggaaagcgaatccaaacggttgtgatctaaagaatcaataagcctcaagccttatgtttctccaatgttacgctcgcttgcctagctttacgaatattgctttgttttctgtttatgcatagccttgatttgtttgactcccctccccccatttacatgcatgcaatcagacaggccactaaggtaaaagagtctgctctatcatagtgttgagagcgtgtgtagtgctgcatcttatgacaaggggacagacaagctgggacgtcagggaaatgaacaaaagggacgcaggttatttggggtgagtgggtggtgggagcctggagcaaggtggagggtgcagaggggctggggtagggcatgtaggagggaggtgggtgggtcaggtgagtggaaggggtgttgtatattgtgttgatgacgtacgttatttccatggaagatagccgctgtggcagctgtcacatcaccacagctccctagggtctgccgagaaggcaggcagtctttgggttctgttctttgtcacgtcccctacaagtaaattttgtttctttgaacgtttattaaaatgccaagacccaaccatttcttccacctgcttgattgtgccagtgtttgctcaggcctctttcttagtgttgctttcaaatccttctctttcctgggttgggaaggccaggcagggacagagcaaatgacacttctcttcctcttgccctccctgcctctttggtgctcttaaaagccagcagctgagaacatagcacaggcccacgtggtgagggcacccacagcttaaagacgcttccttctaaacacggcgaggtcacctctcactcttctgtctttgcaaaccgagaagagtggcatgcttctggcatcccaagtcaggattttagctcagatgaggcagaatgaagggcctctcttacaggcagtttgtgtttgattctctcgatcctggcacatccatgataaataggagtttttgaaagttggttttattaggtgttccctaatttttaccgtaataggtcatctcagcttatatgaaagtcaagtggggaactgggaaagccaaagtcagtcttgagcagagggagcacattttgtggacctggttccacctttccattccaaaccacctgtttccccttccattagcagaaactctgggggaactttgtgtctcagtcctagaatctccccaagtgagtggaagtgacatgatgcagtcttcctcatggggcacctgaaagaaattagtgtgggtgcttcgatctaccttgtctgtcagagttgaatatctctttccctatcatgctgcttctgaaaattcagttttggagcaagtcctgtgagcaagataagaatctatagaaccaagatgctcattttcagaagaaatatgttcaacctgggatcagacttccatgctctggggaatccaagtggtagcacctgtaaccctgtgtactaagtgctttgaagagaagagcaggcctcagacaccttttaattgcttaggagaaaccattgtctctgactgcaggtttgaataagttgaagaccagagaaaagtacacactgggctacaaaggaatttggagatagccaaggaacaggatttcccctagcaagctaccttctgttcaaatcatgaaaaaagactatttccccttagaatagggaagcttgctattttaaagctcttgtagtgcttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]