GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:37:21, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_011521753            4775 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens uveal autoantigen with coiled-coil domains
            and ankyrin repeats (UACA), transcript variant X2, mRNA.
ACCESSION   XM_011521753
VERSION     XM_011521753.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000015.10) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 6, 2016 this sequence version replaced XM_011521753.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4775
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
     gene            1..4775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="uveal autoantigen with coiled-coil domains and
                     ankyrin repeats; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 3 mRNAs, 104 ESTs, 59
                     long SRA reads, 2 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     11 samples with support for all annotated introns"
                     /db_xref="GeneID:55075"
                     /db_xref="HGNC:HGNC:15947"
                     /db_xref="MIM:612516"
     variation       5
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208685584"
     variation       9
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550530778"
     variation       14
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464960445"
     variation       19
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033777841"
     variation       24
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:796891739"
     variation       28..29
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:367754460"
     variation       28..29
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1191593327"
     variation       29..37
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggggggg"
                     /replace="ggggggggg"
                     /replace="gggggggggg"
                     /replace="ggggggggggg"
                     /replace="gggggggggggg"
                     /db_xref="dbSNP:rs66634505"
     variation       29..30
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1566982484"
     variation       30..31
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1051705602"
     variation       30
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368210233"
     variation       31
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024512776"
     variation       32..33
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:975418270"
     variation       32
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185639889"
     variation       33..34
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1276791006"
     variation       34..35
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910005066"
     variation       34
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147704535"
     variation       35..36
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1331821541"
     variation       35
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764266341"
     variation       36
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:994730825"
     variation       37
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436331523"
     variation       38..39
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1275548264"
     variation       38
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377727488"
     variation       41
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202023347"
     variation       53
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471492713"
     variation       65
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215584294"
     variation       70
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368232863"
     variation       75
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181186288"
     variation       79
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412695477"
     variation       81
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471108153"
     variation       82
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356107175"
     variation       84
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900448831"
     variation       86
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390148688"
     variation       88
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983262439"
     variation       93
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305192088"
     variation       104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038847960"
     variation       106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368944497"
     variation       112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760895902"
     variation       115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911973986"
     variation       118
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235710172"
     variation       168
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1355484279"
     variation       172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543868014"
     variation       178..179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1243288309"
     variation       184
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042831294"
     variation       194
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355058256"
     variation       197
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:945465991"
     variation       199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293578975"
     variation       214
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1481862982"
     variation       219
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439527265"
     variation       230
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252236678"
     variation       235
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114053695"
     variation       241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:969622308"
     variation       247
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989452598"
     variation       253
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959600588"
     variation       258
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:926890389"
     variation       261
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367753523"
     variation       269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473205014"
     variation       270
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1165531559"
     variation       277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023805881"
     variation       281..284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:1404482188"
     variation       282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329149081"
     variation       290
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010612842"
     variation       292
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112742141"
     variation       293
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751431760"
     variation       297
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766381482"
     variation       298
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341593107"
     variation       299
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246151914"
     variation       300
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558647450"
     variation       307
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030780270"
     variation       312
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544663997"
     variation       319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418628917"
     variation       326
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77950442"
     variation       327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274855597"
     variation       329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015767233"
     variation       330
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983585172"
     variation       344
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481501484"
     variation       351
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773014092"
     variation       352
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255455116"
     variation       358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051608777"
     variation       359..363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1185540164"
     variation       366
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931769824"
     variation       371..373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1448887689"
     CDS             375..4652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /codon_start=1
                     /product="uveal autoantigen with coiled-coil domains and
                     ankyrin repeats isoform X2"
                     /protein_id="XP_011520055.2"
                     /db_xref="GeneID:55075"
                     /db_xref="HGNC:HGNC:15947"
                     /db_xref="MIM:612516"
                     /translation="
MLSLKSIILNVSCISCVLGRFYNSALLMKLAQKGEGNLECNWKISDHAADWNKYDDRLMKAAERGDVEKVTSILAKKGVNPGKLDVEGRSVFHVVTSKGNLECLNAILIHGVDITTSDTAGRNALHLAAKYGHALCLQKLLQYNCPTEHADLQGRTALHDAAMADCPSSIQLLCDHGASVNAKDVDGRTPLVLATQMSRPTICQLLIDRGADVNSRDKQNRTALMLGCEYGCRDAVEVLIKNGADISLLDALGHDSSYYARIGDNLDILTLLKTASENTNKGRELWKKGPSLQQRNLTHMQDEVNVKSHQREHQNIQDLEIENEDLKERLRKIQQEQRILLDKVNGLQLQLNEREKLKSLLAAKEKQHEESLRTIEALKNRFKYFESDHLGSGSHFSNRKEDMLLKQGQMYMADSQCTSPGIPAHMQSRSMLRPLELSLPSQTSYSENEILKKELEAMRTFCESAKQDRLKLQNELAHKVAECKALALECERVKEDSDEQIKQLEDALKDVQKRMYESEGKVKQMQTHFLALKEHLTSEAASGNHRLTEELKDQLKDLKVKYEGASAEVGKLRNQIKQNEMIVEEFKRDEGKLIEENKRLQKELSMCEMEREKKGRKVTEMEGQAKELSAKLALSIPAEKFENMKSSLSNEVNEKAKKLVEMEREHEKSLSEIRQLKRELENVKAKLAQHVKPEEHEQVKSRLEQKSGELGKKITELTLKNQTLQKEIEKVYLDNKLLKEQAHNLTIEMKNHYVPLKVSEDMKKSHDAIIDDLNRKLLDVTQKYTEKKLEMEKLLLENDSLSKDVSRLETVFVPPEKHEKEIIALKSNIVELKKQLSELKKKCGEDQEKIHALTSENTNLKKMMSNQYVPVKTHEEVKMTLNDTLAKTNRELLDVKKKFEDINQEFVKIKDKNEILKRNLENTQNQIKAEYISLAEHEAKMSSLSQSMRKVQDSNAEILANYRKGQEEIVTLHAEIKAQKKELDTIQECIKVKYAPIVSFEECERKFKATEKELKDQLSEQTQKYSVSEEEVKKNKQENDKLKKEIFTLQKDLRDKTVLIEKSHEMERALSRKTDELNKQLKDLSQKYTEVKNVKEKLVEENAKQTSEILAVQNLLQKQHVPLEQVEALKKSLNGTIENLKEELKSMQRCYEKEQQTVTKLHQLLENQKNSSVPLAEHLQIKEAFEKEVGIIKASLREKEEESQNKMEEVSKLQSEVQNTKQALKKLETREVVDLSKYKATKSDLETQISSLNEKLANLNRKYEEVCEEVLHAKKKEISAKDEKELLHFSIEQEIKDQKERCDKSLTTITELQRRIQESAKQIEAKDNKITELLNDVERLKQALNGLSQLTYTSGNPTKRQSQLIDTLQHQVKSLEQQLADADRQHQEVIAIYRTHLLSAAQGHMDEDVQEALLQIIQMRQGLVC"
     variation       378
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169478233"
     variation       381
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:900422561"
     variation       382
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464919190"
     variation       383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552990839"
     variation       391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234759756"
     variation       428
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:530661833"
     variation       429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451351524"
     variation       443..446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:941402250"
     variation       443
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319084444"
     variation       458
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216070791"
     variation       459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295930648"
     variation       462
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909859468"
     variation       465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1230857168"
     variation       466
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982908902"
     variation       467
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:536555379"
     variation       489
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205502504"
     variation       500
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266102099"
     variation       504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464501166"
     variation       508
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568075174"
     variation       511
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900417778"
     variation       517
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414726662"
     variation       520
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764388081"
     variation       522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190479083"
     variation       525
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753147635"
     variation       530
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396214654"
     variation       531..533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1199799532"
     variation       535
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765854482"
     variation       539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762535864"
     variation       540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772919419"
     variation       542
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322713585"
     variation       543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292585112"
     variation       544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760320320"
     variation       545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764948976"
     variation       546
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145243489"
     variation       547..552
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tga"
                     /replace="tgatga"
                     /db_xref="dbSNP:1386137188"
     variation       550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200107284"
     variation       551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772580072"
     variation       554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349844862"
     variation       556
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388399048"
     variation       560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144251833"
     variation       565..570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:1566981928"
     variation       565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458175472"
     variation       566
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886332937"
     variation       567
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746900667"
     variation       569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304983"
     variation       570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772108083"
     variation       571
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139520381"
     variation       573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949681789"
     variation       575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779006069"
     variation       581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908676712"
     variation       585
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982980262"
     variation       586
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950429441"
     variation       587
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4776525"
     variation       591
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576352018"
     variation       593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549224209"
     variation       598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1201845955"
     variation       600
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488993066"
     variation       602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756445577"
     variation       604
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764828191"
     variation       606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355491607"
     variation       607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377680103"
     variation       608
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755579260"
     variation       609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371918252"
     variation       610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303262408"
     variation       613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764865567"
     variation       615
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339574450"
     variation       616
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757762436"
     variation       619
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163448229"
     variation       620
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398383857"
     variation       625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362621562"
     variation       626
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305757864"
     variation       631
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762625258"
     variation       635
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442593483"
     variation       645
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244928153"
     variation       647
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304730821"
     variation       652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749452750"
     variation       654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199674938"
     variation       656
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353578741"
     variation       657
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169187149"
     variation       662
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756422766"
     variation       666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748426431"
     variation       668..671
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1170387613"
     variation       669
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1001647122"
     variation       670
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186379110"
     variation       671
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440397734"
     variation       672
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1257660840"
     variation       675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200466441"
     variation       680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144740902"
     variation       688
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755496829"
     variation       690
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752147626"
     variation       693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199557627"
     variation       700
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372106995"
     variation       702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756845017"
     variation       704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372824577"
     variation       708
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763651305"
     variation       710
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760416879"
     variation       712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143934745"
     variation       714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368204874"
     variation       715
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139963947"
     variation       718
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290089484"
     variation       720
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467685570"
     variation       721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774284055"
     variation       730
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163111259"
     variation       731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770909619"
     variation       733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1369779891"
     variation       740
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197933688"
     variation       747
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752397778"
     variation       750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292288824"
     variation       755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767241211"
     variation       757
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759312731"
     variation       758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575121985"
     variation       760
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766269411"
     variation       764
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762994459"
     variation       769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776691128"
     variation       770
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038668421"
     variation       772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773114002"
     variation       773
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769951675"
     variation       776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969352633"
     variation       779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761876986"
     variation       780
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304200216"
     variation       781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777009991"
     variation       786
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358169206"
     variation       787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1160109907"
     variation       790
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769060788"
     variation       795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272656817"
     variation       796
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747374334"
     variation       798
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482752531"
     variation       799
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170715310"
     variation       803
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370445328"
     variation       804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775635325"
     variation       805
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61741208"
     variation       806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425559828"
     variation       814
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373663999"
     variation       816
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750381521"
     variation       818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765177088"
     variation       819
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179110010"
     variation       820
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386906367"
     variation       825
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370021264"
     variation       827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776918046"
     variation       829
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764380928"
     variation       830
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328660098"
     variation       831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761029311"
     variation       832
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974703083"
     variation       833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775949594"
     variation       834
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772488174"
     variation       837
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746300849"
     variation       844
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952266634"
     variation       845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370534833"
     variation       846
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375703457"
     variation       849
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282084972"
     variation       851
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771406773"
     variation       852
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747622571"
     variation       857
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559637926"
     variation       858
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150678830"
     variation       861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537637071"
     variation       862
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568890167"
     variation       862
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1253227195"
     variation       864
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178317282"
     variation       865
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013155635"
     variation       874
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980202429"
     variation       875
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201525940"
     variation       878
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566976158"
     variation       881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771692697"
     variation       882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745645569"
     variation       884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200529188"
     variation       885
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141940448"
     variation       888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247226009"
     variation       900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757214469"
     variation       901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753859325"
     variation       904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148128872"
     variation       908
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1307576177"
     variation       911..914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:748824469"
     variation       919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317718258"
     variation       921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199625101"
     variation       922
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577583531"
     variation       927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767747054"
     variation       929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751899551"
     variation       932
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575135370"
     variation       933
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955058992"
     variation       934
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191038243"
     variation       936
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756160531"
     variation       937
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027916003"
     variation       940
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996559283"
     variation       941
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888097908"
     variation       949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264885939"
     variation       956
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048075076"
     variation       958
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774044627"
     variation       962
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199643973"
     variation       965
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276134047"
     variation       969
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278582950"
     variation       971
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752798754"
     variation       974
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781150235"
     variation       976
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296581984"
     variation       977
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395484392"
     variation       978
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201050468"
     variation       980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147378902"
     variation       981
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470619919"
     variation       982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766710720"
     variation       983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763293792"
     variation       987
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463864174"
     variation       987
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="ta"
                     /db_xref="dbSNP:376160405"
     variation       992
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373236592"
     variation       993
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378097878"
     variation       995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139165884"
     variation       996
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287172841"
     variation       997
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421512462"
     variation       998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765706515"
     variation       1002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762356912"
     variation       1006
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775017793"
     variation       1007
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759163989"
     variation       1009
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773860365"
     variation       1010
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142735122"
     variation       1020
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749060432"
     variation       1025
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138672950"
     variation       1026
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314396533"
     variation       1027
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947475803"
     variation       1029
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769801962"
     variation       1030
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453478751"
     variation       1032
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283260161"
     variation       1034
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928634952"
     variation       1038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376651877"
     variation       1043
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762717061"
     variation       1044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405222421"
     variation       1046
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145754980"
     variation       1047
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149120122"
     variation       1049
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225994798"
     variation       1050
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748057752"
     variation       1052
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196944776"
     variation       1058
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746059009"
     variation       1059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368611824"
     variation       1063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938177378"
     variation       1064
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483419222"
     variation       1079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202142485"
     variation       1080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:755443569"
     variation       1080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747032491"
     variation       1082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282320019"
     variation       1086
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780161131"
     variation       1088
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351944623"
     variation       1090
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758567740"
     variation       1091..1092
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:747345977"
     variation       1091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222017133"
     variation       1094
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138086966"
     variation       1095
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193950322"
     variation       1100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392326783"
     variation       1101
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199497578"
     variation       1104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536787451"
     variation       1108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754294636"
     variation       1111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764476030"
     variation       1114
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756692970"
     variation       1120
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549811052"
     variation       1126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766014158"
     variation       1127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624989"
     variation       1133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157362356"
     variation       1135
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773009171"
     variation       1137
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384841660"
     variation       1142
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933395435"
     variation       1147
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475247322"
     variation       1148
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240582913"
     variation       1150
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764995653"
     variation       1151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761511146"
     variation       1152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776532990"
     variation       1158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768459344"
     variation       1159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760688895"
     variation       1163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164741404"
     variation       1167
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320626526"
     variation       1168
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775508502"
     variation       1169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218411195"
     variation       1170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772144245"
     variation       1175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271590081"
     variation       1179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746033972"
     variation       1181
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:567529933"
     variation       1186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366671651"
     variation       1188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771223179"
     variation       1192
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438272750"
     variation       1195
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201109696"
     variation       1197
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470949991"
     variation       1199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150361297"
     variation       1200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988228657"
     variation       1201
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778220594"
     variation       1202
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756537761"
     variation       1207
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258930295"
     variation       1210
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349863148"
     variation       1212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753257290"
     variation       1213
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975711700"
     variation       1220..1225
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gagaga"
                     /replace="gagagaga"
                     /db_xref="dbSNP:1024431721"
     variation       1220
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770205119"
     variation       1228
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988124378"
     variation       1229
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143150748"
     variation       1230
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748578187"
     variation       1235
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244247162"
     variation       1242
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144905097"
     variation       1245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755585403"
     variation       1247
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479849974"
     variation       1254
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235019364"
     variation       1257
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148156777"
     variation       1258
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777479598"
     variation       1265
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288295243"
     variation       1266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373823406"
     variation       1267
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370959404"
     variation       1269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767328670"
     variation       1275
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1480298310"
     variation       1277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754838700"
     variation       1279
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1201123710"
     variation       1281
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995393187"
     variation       1291
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478172484"
     variation       1299
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260622295"
     variation       1300
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202800502"
     variation       1301
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146712252"
     variation       1310
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766284405"
     variation       1316
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203011477"
     variation       1317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763082528"
     variation       1323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264845374"
     variation       1325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223900439"
     variation       1327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463261843"
     variation       1329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775760805"
     variation       1331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162316349"
     variation       1337
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772579838"
     variation       1349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759989049"
     variation       1355..1360
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1248226204"
     variation       1356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184179132"
     variation       1357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772639630"
     variation       1367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769302585"
     variation       1374
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295344316"
     variation       1377..1385
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="caagaacaa"
                     /replace="caagaacaagaacaa"
                     /db_xref="dbSNP:1275644276"
     variation       1377
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747714236"
     variation       1380
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397224882"
     variation       1384..1386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1198423691"
     variation       1387
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780818072"
     variation       1390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357417941"
     variation       1395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979060947"
     variation       1404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145715387"
     variation       1406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61746369"
     variation       1407
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566970715"
     variation       1408
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746365"
     variation       1411..1412
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:752630677"
     variation       1411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376789292"
     variation       1422
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758317449"
     variation       1425
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302182766"
     variation       1428
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750333142"
     variation       1440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867191492"
     variation       1444
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361173843"
     variation       1445
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760318791"
     variation       1450
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383103981"
     variation       1458
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372300506"
     variation       1460
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565517215"
     variation       1472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475113537"
     variation       1477
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771828314"
     variation       1478
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319431733"
     variation       1480
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745631620"
     variation       1485
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465694321"
     variation       1486
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243090307"
     variation       1488
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774340258"
     variation       1494
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314345049"
     variation       1497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770945768"
     variation       1498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749239182"
     variation       1503
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184375610"
     variation       1509..1513
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1566969951"
     variation       1513
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418353952"
     variation       1514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741196"
     variation       1515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1566969944"
     variation       1516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748323152"
     variation       1552
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774221009"
     variation       1554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405278410"
     variation       1563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325480584"
     variation       1564
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228442003"
     variation       1568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770861703"
     variation       1569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749149499"
     variation       1574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945191881"
     variation       1577
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773108087"
     variation       1578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465988518"
     variation       1579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174815224"
     variation       1581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553785289"
     variation       1582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761839722"
     variation       1587
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913701457"
     variation       1590..1595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaacaa"
                     /db_xref="dbSNP:1297344563"
     variation       1590..1592
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1428444297"
     variation       1591
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:976029823"
     variation       1598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266308167"
     variation       1599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776507272"
     variation       1606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768738122"
     variation       1608
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150049035"
     variation       1612
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112415946"
     variation       1618..1621
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:1566967325"
     variation       1618
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574725954"
     variation       1620
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772324074"
     variation       1624
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202844390"
     variation       1626
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776619025"
     variation       1630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768648048"
     variation       1633
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235618053"
     variation       1636
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760715088"
     variation       1645
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775600260"
     variation       1650
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283869153"
     variation       1667
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139369634"
     variation       1675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746136094"
     variation       1679
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321769231"
     variation       1680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774515740"
     variation       1682
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771310964"
     variation       1684..1724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tatctttacccagtcaaacgtcatactctgaaaatgaaatt"
                     /replace="tatctttacccagtcaaacgtcatactctgaaaatgaaattatcttta
                     cccagtcaaacgtcatactctgaaaatgaaatt"
                     /db_xref="dbSNP:750095912"
     variation       1685
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749680290"
     variation       1690
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147499743"
     variation       1693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897579140"
     variation       1696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200591121"
     variation       1702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142769157"
     variation       1703
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570402849"
     variation       1707
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757920252"
     variation       1715
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1455895333"
     variation       1724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182860391"
     variation       1727..1735
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaga"
                     /replace="aaagaaaga"
                     /db_xref="dbSNP:1200815816"
     variation       1728
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157224002"
     variation       1731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379997134"
     variation       1735
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750101761"
     variation       1736
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386536409"
     variation       1739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483733617"
     variation       1742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764857714"
     variation       1743
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226323671"
     variation       1744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344354609"
     variation       1748
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299016704"
     variation       1749
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757072272"
     variation       1750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753673926"
     variation       1756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322532596"
     variation       1758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551986241"
     variation       1766
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236304709"
     variation       1774
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001451916"
     variation       1775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78821209"
     variation       1778
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537236890"
     variation       1779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369379599"
     variation       1780
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571781334"
     variation       1783
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370575616"
     variation       1787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162858778"
     variation       1788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566966234"
     variation       1789
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471807664"
     variation       1790
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370103425"
     variation       1795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566966222"
     variation       1797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1209298850"
     variation       1797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188053967"
     variation       1798
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253935608"
     variation       1804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147152893"
     variation       1806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469993608"
     variation       1814
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771094058"
     variation       1821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250115960"
     variation       1824
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931827501"
     variation       1825
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867253624"
     variation       1827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749637765"
     variation       1831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420006408"
     variation       1834
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191011342"
     variation       1835
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375893173"
     variation       1849
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748668041"
     variation       1851
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539534982"
     variation       1854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757914518"
     variation       1856
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163578023"
     variation       1857
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246027586"
     variation       1859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1335497796"
     variation       1861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923147961"
     variation       1862
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052494407"
     variation       1867
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745438939"
     variation       1872
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778596630"
     variation       1875
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372485796"
     variation       1879
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403071720"
     variation       1880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538327129"
     variation       1884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308811624"
     variation       1892
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040186718"
     variation       1898..1901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:764913324"
     variation       1901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338495342"
     variation       1902
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426982968"
     variation       1903
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935486637"
     variation       1904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372813692"
     variation       1906
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274030713"
     variation       1913
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200898543"
     variation       1914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753584998"
     variation       1919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571464088"
     variation       1921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755982027"
     variation       1925
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473730350"
     variation       1926
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252790170"
     variation       1929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198301540"
     variation       1931
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566572244"
     variation       1932
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292671501"
     variation       1937
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767418284"
     variation       1949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337290879"
     variation       1951
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350415570"
     variation       1954
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266700509"
     variation       1957
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230606808"
     variation       1967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1481218749"
     variation       1976
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759626819"
     variation       1979
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774338996"
     variation       1987
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766571413"
     variation       1988
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332269324"
     variation       1989
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147142448"
     variation       1990
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381510765"
     variation       1992
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386348273"
     variation       1994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773643136"
     variation       1998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1457548131"
     variation       1999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769242051"
     variation       2000
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762325166"
     variation       2003
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777192081"
     variation       2008
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368193973"
     variation       2011
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769084461"
     variation       2018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745363839"
     variation       2019
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1167864673"
     variation       2019
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374373516"
     variation       2022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353434609"
     variation       2024
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188217497"
     variation       2029
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1566965906"
     variation       2030
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748949025"
     variation       2031
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946732138"
     variation       2037
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211011324"
     variation       2038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266089926"
     variation       2040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973029319"
     variation       2041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941670591"
     variation       2049
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777490563"
     variation       2051
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916827234"
     variation       2052
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375230873"
     variation       2053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370993832"
     variation       2055
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755896148"
     variation       2057
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262141192"
     variation       2059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752525197"
     variation       2060
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141625629"
     variation       2067
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754891956"
     variation       2068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566965837"
     variation       2071..2076
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cag"
                     /replace="cagcag"
                     /db_xref="dbSNP:1312173141"
     variation       2072
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226035123"
     variation       2087
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035144433"
     variation       2089
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751617518"
     variation       2095
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322418730"
     variation       2096
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766372312"
     variation       2100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277583685"
     variation       2104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308156923"
     variation       2110
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405011603"
     variation       2114
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972902015"
     variation       2119..2124
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:761259954"
     variation       2127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765082684"
     variation       2128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1241524280"
     variation       2128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983130163"
     variation       2129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763209812"
     variation       2139..2143
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ga"
                     /replace="gatga"
                     /db_xref="dbSNP:1483236528"
     variation       2141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1014700431"
     variation       2148
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750659290"
     variation       2150
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765623117"
     variation       2151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260089275"
     variation       2152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762237342"
     variation       2156
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776911245"
     variation       2164
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542712606"
     variation       2169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1566965737"
     variation       2169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428584780"
     variation       2170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143460657"
     variation       2171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761120761"
     variation       2175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389271529"
     variation       2177
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392493964"
     variation       2181
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434063535"
     variation       2187..2190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="agta"
                     /db_xref="dbSNP:776234127"
     variation       2188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237191959"
     variation       2190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530712413"
     variation       2191
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566965692"
     variation       2199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372319891"
     variation       2201
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278858554"
     variation       2202
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867923886"
     variation       2205
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748859067"
     variation       2206
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761442046"
     variation       2207
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377063029"
     variation       2209
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299751588"
     variation       2212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777370351"
     variation       2217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381941641"
     variation       2219..2225
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagaaag"
                     /db_xref="dbSNP:752971680"
     variation       2220
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769480423"
     variation       2224
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368054323"
     variation       2230
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143605384"
     variation       2231
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762372831"
     variation       2232
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754876721"
     variation       2235
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751462507"
     variation       2236
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171037362"
     variation       2241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780096426"
     variation       2242
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750571401"
     variation       2245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765534267"
     variation       2248
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957984005"
     variation       2249
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440239377"
     variation       2250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182468125"
     variation       2253
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566965605"
     variation       2262
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237719512"
     variation       2263
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764373773"
     variation       2264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189747910"
     variation       2266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1276241026"
     variation       2267
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205237913"
     variation       2272
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149316568"
     variation       2273
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935185666"
     variation       2274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287603706"
     variation       2276..2285
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttcca"
                     /replace="ttccattcca"
                     /db_xref="dbSNP:1209304699"
     variation       2278
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051919371"
     variation       2289
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1379562256"
     variation       2303
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137905046"
     variation       2304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409364953"
     variation       2314
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772729423"
     variation       2315
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769394198"
     variation       2318
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900765014"
     variation       2323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417619180"
     variation       2336
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777042000"
     variation       2341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345977854"
     variation       2342..2348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:761196686"
     variation       2342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144753268"
     variation       2347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776427691"
     variation       2349..2350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1407455541"
     variation       2349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:916605642"
     variation       2350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291808645"
     variation       2355
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768322363"
     variation       2358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990837009"
     variation       2359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181905465"
     variation       2365
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746888229"
     variation       2367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780109504"
     variation       2369
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182318688"
     variation       2377..2390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aatcacttagtgaa"
                     /db_xref="dbSNP:776135225"
     variation       2382
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487849376"
     variation       2383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244932965"
     variation       2386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223599749"
     variation       2396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267339515"
     variation       2399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352221163"
     variation       2400
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226330202"
     variation       2402..2406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaaga"
                     /db_xref="dbSNP:1217943474"
     variation       2404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758459810"
     variation       2408
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374297683"
     variation       2411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779167032"
     variation       2420
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757490219"
     variation       2421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307499623"
     variation       2422
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235939807"
     variation       2424
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140635691"
     variation       2430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754023228"
     variation       2432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317092567"
     variation       2434
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764438751"
     variation       2436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756435149"
     variation       2440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158956599"
     variation       2442
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753151975"
     variation       2444
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146812558"
     variation       2445
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150332740"
     variation       2446..2462
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tcaaaccagaggaacat"
                     /db_xref="dbSNP:1247316402"
     variation       2448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432106607"
     variation       2449
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764739595"
     variation       2459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761443025"
     variation       2461
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488797117"
     variation       2468
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776143210"
     variation       2469
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140160623"
     variation       2470..2471
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:772377977"
     variation       2476
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746758700"
     variation       2478
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311824317"
     variation       2479
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299359674"
     variation       2483..2486
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="agaa"
                     /db_xref="dbSNP:970273738"
     variation       2483
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979975050"
     variation       2487
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557645324"
     variation       2495
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775448576"
     variation       2504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772096665"
     variation       2505
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199892116"
     variation       2506
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779081391"
     variation       2507..2514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:1375990005"
     variation       2507
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936438"
     variation       2510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866060046"
     variation       2519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373326012"
     variation       2522..2524
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtt"
                     /db_xref="dbSNP:1270870020"
     variation       2526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777832416"
     variation       2528
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756377521"
     variation       2529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148252688"
     variation       2532
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274537467"
     variation       2537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767869140"
     variation       2538
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578213404"
     variation       2548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566965237"
     variation       2554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1435955969"
     variation       2557..2558
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1451108300"
     variation       2557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558028386"
     variation       2562
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373285275"
     variation       2566
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766938380"
     variation       2569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761196411"
     variation       2570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753438291"
     variation       2571
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179954027"
     variation       2573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763604401"
     variation       2575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996377083"
     variation       2576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212377743"
     variation       2583
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760408838"
     variation       2585
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297526559"
     variation       2586
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398223085"
     variation       2595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029042423"
     variation       2601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226748397"
     variation       2602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775358941"
     variation       2603..2611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="taac"
                     /replace="taacttaac"
                     /db_xref="dbSNP:746217937"
     variation       2607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296811524"
     variation       2609..2613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:1378003575"
     variation       2610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409830101"
     variation       2613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995870019"
     variation       2619
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79724871"
     variation       2621
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304177552"
     variation       2623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434816509"
     variation       2626
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772008800"
     variation       2629..2633
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:768133711"
     variation       2632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774430262"
     variation       2633
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142981855"
     variation       2637
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1186628370"
     variation       2638
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566442081"
     variation       2639
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749274778"
     variation       2651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183755247"
     variation       2654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1233546440"
     variation       2655
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486042331"
     variation       2660
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374407527"
     variation       2662
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294530834"
     variation       2664
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777936135"
     variation       2666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203089850"
     variation       2670
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1344994724"
     variation       2674
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769838106"
     variation       2676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244552166"
     variation       2677
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368722238"
     variation       2678
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265370501"
     variation       2679
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314440584"
     variation       2680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781449269"
     variation       2684..2690
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgat"
                     /replace="tgatgat"
                     /db_xref="dbSNP:886129812"
     variation       2686
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999303820"
     variation       2694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115305380"
     variation       2696..2698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:771141640"
     variation       2696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043813141"
     variation       2699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566965008"
     variation       2702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751960436"
     variation       2703
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256574910"
     variation       2705
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780402434"
     variation       2715
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143107777"
     variation       2725
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746153669"
     variation       2726
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763666095"
     variation       2727
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475118411"
     variation       2736
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760189268"
     variation       2738
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475690959"
     variation       2739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114734080"
     variation       2744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055504626"
     variation       2747
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767347929"
     variation       2748
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251895617"
     variation       2749
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209699606"
     variation       2753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759376888"
     variation       2758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267670492"
     variation       2759
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774340474"
     variation       2765
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328099333"
     variation       2777
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770730167"
     variation       2779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762949630"
     variation       2781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335772850"
     variation       2784
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322815679"
     variation       2785
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928183718"
     variation       2787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037315077"
     variation       2793
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550619844"
     variation       2794
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530685196"
     variation       2798
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748293056"
     variation       2802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456477947"
     variation       2803
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411541636"
     variation       2804..2808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:749389307"
     variation       2804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157150095"
     variation       2805
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226026499"
     variation       2807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270305251"
     variation       2810
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781361234"
     variation       2811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747325846"
     variation       2823
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200006843"
     variation       2826
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780499099"
     variation       2830
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140445271"
     variation       2838
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934543893"
     variation       2839
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212832355"
     variation       2840
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383721061"
     variation       2842
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3743315"
     variation       2843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779348840"
     variation       2844
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755684641"
     variation       2845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146530294"
     variation       2859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144149272"
     variation       2866
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141249659"
     variation       2870
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751243389"
     variation       2877
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766207502"
     variation       2879
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139052072"
     variation       2881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436953298"
     variation       2882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150709937"
     variation       2885
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761857749"
     variation       2890
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565495606"
     variation       2891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240440235"
     variation       2893
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768826242"
     variation       2896
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866984332"
     variation       2900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200395651"
     variation       2901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529227646"
     variation       2905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772473505"
     variation       2906
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746288247"
     variation       2912
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194746304"
     variation       2915
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449245811"
     variation       2917
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022511481"
     variation       2926
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438169337"
     variation       2927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181818682"
     variation       2928
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757891331"
     variation       2933
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236184502"
     variation       2934
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747617330"
     variation       2935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113034898"
     variation       2936
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277434255"
     variation       2947
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780849532"
     variation       2949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543814859"
     variation       2954..2961
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:1350165153"
     variation       2954
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751208406"
     variation       2959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227665151"
     variation       2960..2967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gatgatga"
                     /replace="gatgatgatga"
                     /db_xref="dbSNP:1566964634"
     variation       2961
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362931327"
     variation       2962
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766011610"
     variation       2964
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376472787"
     variation       2966
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431162816"
     variation       2967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327281597"
     variation       2968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372114429"
     variation       2970
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750233015"
     variation       2973
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412850542"
     variation       2981
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765110929"
     variation       2995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174334195"
     variation       3001
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572194470"
     variation       3002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61742861"
     variation       3007
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055238133"
     variation       3011
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776626083"
     variation       3012
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373897961"
     variation       3013
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236554388"
     variation       3025
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760804726"
     variation       3026
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370496255"
     variation       3035..3041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aac"
                     /replace="aactaac"
                     /db_xref="dbSNP:1371591644"
     variation       3037
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280498533"
     variation       3038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203787188"
     variation       3041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340023525"
     variation       3042..3046
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:777766591"
     variation       3044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274980061"
     variation       3046..3050
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aatta"
                     /db_xref="dbSNP:1355309424"
     variation       3050
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304525321"
     variation       3052
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772226288"
     variation       3053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267931146"
     variation       3054
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446173919"
     variation       3056
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746224315"
     variation       3059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:756184473"
     variation       3067
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774605454"
     variation       3068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771493657"
     variation       3069
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749822960"
     variation       3070
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778478573"
     variation       3072
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201529951"
     variation       3075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754528890"
     variation       3077
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377221680"
     variation       3078
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779733419"
     variation       3080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940222197"
     variation       3081
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766173619"
     variation       3084
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758008300"
     variation       3088
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750193346"
     variation       3091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778685231"
     variation       3093
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190718928"
     variation       3101
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762576820"
     variation       3104..3108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="agata"
                     /db_xref="dbSNP:1402710829"
     variation       3105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753763851"
     variation       3110
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764087607"
     variation       3111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1332224732"
     variation       3113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:924540713"
     variation       3115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337270794"
     variation       3117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413673713"
     variation       3122..3126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1474040206"
     variation       3122
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465299577"
     variation       3128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760779968"
     variation       3130
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227885264"
     variation       3132
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752771670"
     variation       3136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767734444"
     variation       3141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:572636096"
     variation       3142
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186541436"
     variation       3143
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974501075"
     variation       3149
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463306916"
     variation       3150
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201393156"
     variation       3151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770471453"
     variation       3152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746477639"
     variation       3155
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750139193"
     variation       3156
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:911516443"
     variation       3158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771689094"
     variation       3162
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745522222"
     variation       3164
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391733409"
     variation       3167
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778595564"
     variation       3170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977733665"
     variation       3172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569081139"
     variation       3175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244875719"
     variation       3179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215364258"
     variation       3182
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468712893"
     variation       3185
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138757062"
     variation       3186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144820825"
     variation       3188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761275966"
     variation       3190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567387793"
     variation       3198
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1315343704"
     variation       3199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293917832"
     variation       3200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011137827"
     variation       3202
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142570134"
     variation       3203
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756032048"
     variation       3212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301816495"
     variation       3216
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566964256"
     variation       3218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752786283"
     variation       3226
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767504087"
     variation       3230..3231
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1320303593"
     variation       3234
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759716420"
     variation       3239
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145177868"
     variation       3240
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766776608"
     variation       3244
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763399066"
     variation       3248
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481269884"
     variation       3250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202233435"
     variation       3252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773727019"
     variation       3256
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454552195"
     variation       3259
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143299796"
     variation       3261
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206572054"
     variation       3263..3266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1566964208"
     variation       3268
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770270564"
     variation       3270
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262673982"
     variation       3273
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216618477"
     variation       3275
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762259073"
     variation       3276
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775015884"
     variation       3284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771459849"
     variation       3290
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745420520"
     variation       3291
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867743924"
     variation       3295
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199811737"
     variation       3296
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372349789"
     variation       3297
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776238893"
     variation       3300
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186785151"
     variation       3310..3317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:747011009"
     variation       3314
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778530154"
     variation       3315..3316
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1380852623"
     variation       3323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149154885"
     variation       3324
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377062806"
     variation       3325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037005896"
     variation       3327..3335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="acaa"
                     /replace="acaatacaa"
                     /db_xref="dbSNP:984944897"
     variation       3328
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167760889"
     variation       3330
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777545622"
     variation       3337
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462458974"
     variation       3339
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229574674"
     variation       3342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200262267"
     variation       3344
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373954045"
     variation       3346
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781233334"
     variation       3347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186479155"
     variation       3350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430033055"
     variation       3356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934005"
     variation       3357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187267933"
     variation       3358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483047561"
     variation       3359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751749504"
     variation       3360
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766651986"
     variation       3361
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349283189"
     variation       3362
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274496633"
     variation       3363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565566100"
     variation       3366
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150013138"
     variation       3368
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762286800"
     variation       3374
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003526969"
     variation       3376
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293401872"
     variation       3378
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150396339"
     variation       3380
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295852845"
     variation       3383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764727706"
     variation       3384
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759030929"
     variation       3390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314224198"
     variation       3391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78910436"
     variation       3394
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770500675"
     variation       3401
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378745086"
     variation       3404..3408
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1373504461"
     variation       3404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1309748995"
     variation       3405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166029557"
     variation       3406..3413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agaa"
                     /replace="agaaagaa"
                     /db_xref="dbSNP:779948888"
     variation       3407
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463337434"
     variation       3411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257749507"
     variation       3413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761282559"
     variation       3414
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186538346"
     variation       3421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423512004"
     variation       3423
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900040152"
     variation       3424
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892903658"
     variation       3426
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1255628584"
     variation       3428
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190186663"
     variation       3429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748967422"
     variation       3432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772971250"
     variation       3437
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1393260936"
     variation       3440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769448570"
     variation       3442..3445
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1433847781"
     variation       3446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201129903"
     variation       3448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533405767"
     variation       3449
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747020540"
     variation       3452
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780313659"
     variation       3453
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758644950"
     variation       3454
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1428916618"
     variation       3459..3468
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaagaag"
                     /replace="gaagaagaag"
                     /db_xref="dbSNP:752051341"
     variation       3461
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750650986"
     variation       3462
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370665811"
     variation       3463
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911653516"
     variation       3466
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377370063"
     variation       3467
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761172640"
     variation       3469
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566963853"
     variation       3472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292771673"
     variation       3478
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977702702"
     variation       3483
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773806522"
     variation       3486
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765892818"
     variation       3493
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475577182"
     variation       3495..3501
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aagttaa"
                     /db_xref="dbSNP:766568043"
     variation       3495
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363364328"
     variation       3498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762493874"
     variation       3500..3505
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:764821090"
     variation       3501..3506
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:756877452"
     variation       3504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772738557"
     variation       3505..3509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:753401958"
     variation       3509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769550419"
     variation       3516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:763761269"
     variation       3517..3519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1251031317"
     variation       3517
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485902818"
     variation       3518
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328037304"
     variation       3519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747843231"
     variation       3521
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564610970"
     variation       3523
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453756158"
     variation       3526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923326489"
     variation       3529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139290693"
     variation       3533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427027182"
     variation       3538
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115468507"
     variation       3539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200022948"
     variation       3542
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396315633"
     variation       3543..3545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1326328053"
     variation       3543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346073421"
     variation       3544
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144888058"
     variation       3547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462217381"
     variation       3551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384497021"
     variation       3553
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150879212"
     variation       3570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746025331"
     variation       3572
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364894691"
     variation       3574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193485115"
     variation       3577
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1453114233"
     variation       3579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255352641"
     variation       3581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778988212"
     variation       3588
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446110801"
     variation       3594
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757511713"
     variation       3595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367717515"
     variation       3597
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1350690111"
     variation       3599
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151082439"
     variation       3600
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232074099"
     variation       3601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144784600"
     variation       3605..3613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaca"
                     /replace="aaacaaaca"
                     /db_xref="dbSNP:760248027"
     variation       3605..3606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1434046169"
     variation       3605
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753175278"
     variation       3607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762440473"
     variation       3609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749966397"
     variation       3610..3613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaca"
                     /db_xref="dbSNP:776187194"
     variation       3610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566963604"
     variation       3611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764731158"
     variation       3616
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201495100"
     variation       3617..3620
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:768033647"
     variation       3618..3622
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaaga"
                     /db_xref="dbSNP:759845763"
     variation       3621
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61729919"
     variation       3624
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981738348"
     variation       3631
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374484868"
     variation       3638
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768549664"
     variation       3639
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760587117"
     variation       3640
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775563177"
     variation       3641
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749286770"
     variation       3643
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447209836"
     variation       3646
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256260967"
     variation       3648
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208069831"
     variation       3659..3663
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1350011472"
     variation       3660
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462360350"
     variation       3661
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112724542"
     variation       3666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180946566"
     variation       3668
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566963487"
     variation       3683
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041165424"
     variation       3688
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772610492"
     variation       3690..3691
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1291392072"
     variation       3698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441900290"
     variation       3702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:774725796"
     variation       3702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227412444"
     variation       3705
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779052323"
     variation       3706
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771016231"
     variation       3709
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566466849"
     variation       3712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312398424"
     variation       3713
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60600939"
     variation       3717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1032768595"
     variation       3722
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301398857"
     variation       3723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143154561"
     variation       3724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228452639"
     variation       3725
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042148247"
     variation       3727..3733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaca"
                     /replace="aacaaca"
                     /db_xref="dbSNP:552400386"
     variation       3730
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409751072"
     variation       3731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291910130"
     variation       3732
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998603734"
     variation       3733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753122092"
     variation       3734
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566963385"
     variation       3735
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169990957"
     variation       3738
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475565207"
     variation       3739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566963372"
     variation       3740
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:903041127"
     variation       3741
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945027721"
     variation       3747
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781623644"
     variation       3749
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486338070"
     variation       3755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755483322"
     variation       3757
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777911577"
     variation       3762..3767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1475565609"
     variation       3767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417486764"
     variation       3769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165117759"
     variation       3771
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749863215"
     variation       3772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274916743"
     variation       3775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764825647"
     variation       3783
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318917370"
     variation       3786
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753497715"
     variation       3787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329897637"
     variation       3790
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763904811"
     variation       3794
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139791694"
     variation       3795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775436524"
     variation       3801
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146031233"
     variation       3804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759546659"
     variation       3805
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754814316"
     variation       3806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188103753"
     variation       3807..3820
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagagtatgcaaag"
                     /db_xref="dbSNP:1566963228"
     variation       3807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546764485"
     variation       3810
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410839490"
     variation       3813
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749398612"
     variation       3814
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162265176"
     variation       3815
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773413932"
     variation       3818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770019747"
     variation       3821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566963221"
     variation       3823
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176101172"
     variation       3827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548726754"
     variation       3828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781569828"
     variation       3833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559274117"
     variation       3836
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796110323"
     variation       3838
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989553182"
     variation       3840
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204990567"
     variation       3843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755393718"
     variation       3845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747528345"
     variation       3848
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746327"
     variation       3849
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756787230"
     variation       3851
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753457065"
     variation       3853
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:981924422"
     variation       3861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763779567"
     variation       3863
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215002996"
     variation       3865
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213927961"
     variation       3870
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150767083"
     variation       3877..3880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1281732084"
     variation       3880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970579095"
     variation       3882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752497204"
     variation       3884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767439854"
     variation       3886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759294074"
     variation       3894
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462736263"
     variation       3895
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866429673"
     variation       3897
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157774747"
     variation       3901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398405690"
     variation       3905
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219987023"
     variation       3909
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410091794"
     variation       3915
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371543852"
     variation       3917
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1240444209"
     variation       3925
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766288503"
     variation       3931
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1250965782"
     variation       3934
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763035452"
     variation       3935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773286699"
     variation       3937
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769966701"
     variation       3942
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281421381"
     variation       3955
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748393199"
     variation       3958
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776890041"
     variation       3961
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433219998"
     variation       3964
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769035026"
     variation       3967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173449925"
     variation       3968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747398460"
     variation       3971
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780597103"
     variation       3972..3980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:749581565"
     variation       3973
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288738264"
     variation       3977
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1026954629"
     variation       3983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1443519032"
     variation       3984
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550285923"
     variation       3986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779816286"
     variation       3989
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777453408"
     variation       3990..3993
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1324173165"
     variation       3993
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346519107"
     variation       3994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159174060"
     variation       3995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1434076328"
     variation       4002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140913353"
     variation       4003
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971565660"
     variation       4004
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175314937"
     variation       4015
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:900068673"
     variation       4016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367322744"
     variation       4018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376705053"
     variation       4019
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767111911"
     variation       4025
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754792990"
     variation       4032
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576595433"
     variation       4038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751329436"
     variation       4040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766275347"
     variation       4041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750052938"
     variation       4043
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:773412063"
     variation       4043
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056326"
     variation       4046..4052
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1250410682"
     variation       4047
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761921200"
     variation       4048
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446489704"
     variation       4052
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776830335"
     variation       4053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768817091"
     variation       4055
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1236977978"
     variation       4058
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313084114"
     variation       4061
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295306150"
     variation       4064
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761042400"
     variation       4067
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775720069"
     variation       4068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193343738"
     variation       4070
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147338503"
     variation       4071
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413585528"
     variation       4074
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373580260"
     variation       4075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466169050"
     variation       4079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314585451"
     variation       4081
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466364119"
     variation       4082..4091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="taaa"
                     /replace="taaatataaa"
                     /db_xref="dbSNP:769915866"
     variation       4082..4083
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1372347806"
     variation       4087
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168032217"
     variation       4090
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746397117"
     variation       4095
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779609784"
     variation       4098
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485354177"
     variation       4104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370637648"
     variation       4105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256034065"
     variation       4109
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213731967"
     variation       4113..4117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:748199092"
     variation       4113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:564736890"
     variation       4115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382398935"
     variation       4130..4132
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:34632458"
     variation       4132
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527950551"
     variation       4133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998635060"
     variation       4136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225658987"
     variation       4140
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747723416"
     variation       4146
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544492679"
     variation       4149
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780844113"
     variation       4152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352946045"
     variation       4153
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294587299"
     variation       4155
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754595776"
     variation       4159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201992560"
     variation       4160
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779738218"
     variation       4162
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758240181"
     variation       4163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373804994"
     variation       4165
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113255037"
     variation       4166
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750331586"
     variation       4170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765225720"
     variation       4171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209393544"
     variation       4174
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761867692"
     variation       4175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415851746"
     variation       4178
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467479016"
     variation       4189
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213617382"
     variation       4199..4205
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaa"
                     /replace="gaaggaa"
                     /db_xref="dbSNP:1566962706"
     variation       4199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753877154"
     variation       4200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424937886"
     variation       4206
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368669913"
     variation       4207
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899633827"
     variation       4209
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764308005"
     variation       4217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756942622"
     variation       4220
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760836364"
     variation       4221
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472074991"
     variation       4222
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772299860"
     variation       4227
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760014936"
     variation       4232
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470269792"
     variation       4233
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143679420"
     variation       4234
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332190606"
     variation       4238
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274550235"
     variation       4242
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369029822"
     variation       4243
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244833921"
     variation       4253
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771581561"
     variation       4263
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747599122"
     variation       4264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392927393"
     variation       4272
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541103929"
     variation       4275
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201043161"
     variation       4276
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768309300"
     variation       4282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005420623"
     variation       4283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292859757"
     variation       4284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746621471"
     variation       4286
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165101429"
     variation       4287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779798678"
     variation       4288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318616573"
     variation       4289
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388262388"
     variation       4290
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363741276"
     variation       4292..4299
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aacaa"
                     /replace="aacaacaa"
                     /db_xref="dbSNP:779889058"
     variation       4294
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294985784"
     variation       4295
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335347127"
     variation       4297
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758185068"
     variation       4313..4320
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1566962581"
     variation       4314
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542436249"
     variation       4317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369571784"
     variation       4321
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566962576"
     variation       4322
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757191526"
     variation       4325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374854267"
     variation       4326
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209929563"
     variation       4335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049036897"
     variation       4338
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250279275"
     variation       4341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349257488"
     variation       4342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764101632"
     variation       4346
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756263317"
     variation       4347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182451243"
     variation       4350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576748008"
     variation       4354..4360
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ataa"
                     /replace="ataataa"
                     /db_xref="dbSNP:758307207"
     variation       4355
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141557783"
     variation       4356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368078785"
     variation       4357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766957344"
     variation       4358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535536215"
     variation       4364..4373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aactg"
                     /replace="aactgaactg"
                     /db_xref="dbSNP:756996963"
     variation       4366
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566961523"
     variation       4367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905956365"
     variation       4375
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200132897"
     variation       4377
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763416581"
     variation       4379
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773588553"
     variation       4383
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765832322"
     variation       4389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760047960"
     variation       4391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774984644"
     variation       4398
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138988448"
     variation       4402
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566961470"
     variation       4404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256719926"
     variation       4407
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547776848"
     variation       4408
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146910380"
     variation       4409
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78551559"
     variation       4411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368965063"
     variation       4417
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450309405"
     variation       4418
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535745285"
     variation       4421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151042907"
     variation       4423
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480459583"
     variation       4427
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002044207"
     variation       4429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781446308"
     variation       4436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941084181"
     variation       4450
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341282473"
     variation       4454
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755161566"
     variation       4459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375621948"
     variation       4461
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150030349"
     variation       4464
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780491610"
     variation       4465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403447526"
     variation       4468
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758676774"
     variation       4473
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393892269"
     variation       4474..4477
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1323109898"
     variation       4474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:753600540"
     variation       4474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750815316"
     variation       4476
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765597280"
     variation       4477
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762411725"
     variation       4479
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234255488"
     variation       4484
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473759839"
     variation       4487
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237936259"
     variation       4488
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752153370"
     variation       4490
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435797405"
     variation       4495
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140236740"
     variation       4502
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759083805"
     variation       4504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933684841"
     variation       4510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1240379077"
     variation       4510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272673604"
     variation       4511
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773984259"
     variation       4514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151171457"
     variation       4515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747020730"
     variation       4521..4529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gacag"
                     /replace="gacagacag"
                     /db_xref="dbSNP:1398918298"
     variation       4522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780214940"
     variation       4526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746078546"
     variation       4527
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868344716"
     variation       4533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779043438"
     variation       4536
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159044303"
     variation       4537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485299506"
     variation       4543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453514839"
     variation       4548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394712701"
     variation       4554
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757610547"
     variation       4555
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749706162"
     variation       4557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201974563"
     variation       4565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756615583"
     variation       4569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487612749"
     variation       4574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751024908"
     variation       4578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420514544"
     variation       4582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157456909"
     variation       4585
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304407458"
     variation       4587
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368378898"
     variation       4588
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554198379"
     variation       4589
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359978954"
     variation       4592
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377324710"
     variation       4596
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170318180"
     variation       4602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865836657"
     variation       4603
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162603788"
     variation       4607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978196574"
     variation       4614
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954400470"
     variation       4622
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044554760"
     variation       4623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143220817"
     variation       4632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139824373"
     variation       4633
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773466932"
     variation       4636
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770143078"
     variation       4638
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111540102"
     variation       4640
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483747316"
     variation       4641
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748522787"
     variation       4642
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196440176"
     variation       4643..4648
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgtgtg"
                     /replace="tgtgtgtg"
                     /db_xref="dbSNP:1227042530"
     variation       4644..4649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtgtgc"
                     /db_xref="dbSNP:866156067"
     variation       4644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769048146"
     variation       4646..4649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtgc"
                     /db_xref="dbSNP:752210788"
     variation       4646
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745343823"
     variation       4647
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373249241"
     variation       4648
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756874021"
     variation       4649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145929072"
     variation       4653
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396531642"
     variation       4654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755923541"
     variation       4655
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141286633"
     variation       4658
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201158136"
     variation       4661
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886388966"
     variation       4666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200933895"
     variation       4669
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772199061"
     variation       4671
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457417587"
     variation       4675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200343329"
     variation       4676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766418592"
     variation       4679
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763090198"
     variation       4682
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:906520715"
     variation       4683
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773413779"
     variation       4690
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1384502490"
     variation       4691
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376522425"
     variation       4696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238358762"
     variation       4697
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212536917"
     variation       4698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941268056"
     variation       4701
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762170475"
     variation       4717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985303826"
     variation       4718
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948180091"
     variation       4720
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561472467"
     variation       4721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544263104"
     variation       4732
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356549977"
     variation       4751
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922431606"
     variation       4756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445902886"
     variation       4765
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261285164"
     variation       4766
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314505135"
     variation       4770
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384151695"
ORIGIN      
cagtactttttaaataaatgtctgtgttgggggggggtagtttcttaaaatgtatgtagaattccactgcatctaagagtcctaggagctatgtaaccagagccaaatctaaaagtgtgatttgaaatctgaaagggtatgggaaaagcacactgattttggaactatagaagtcatggttgggcttttgaacacttaagacatttactgtctctggggccttggcttttcttatctgctaaatggagatgataattttagtttactagggttgattgggactttagtgcctggtacagggtaggtgttcagtagttattgatttccttttttgcctcaaaggcaaagagaactggacagagaacaaaagaaacatgctttccctcaaaagtataattttaaatgtttcttgtatatcatgtgttttgggaagattttataactctgctctcctaatgaagttagcacagaagggagaaggaaatttggaatgcaactggaaaataagtgatcatgcagcagattggaataaatatgatgaccgattgatgaaagcagcagaaaggggggatgtagaaaaagtgacctcaatccttgctaaaaagggggtcaatccaggcaaactagatgtggaaggcagatctgtcttccatgttgtgacctcaaaggggaatcttgagtgtttgaatgccatccttatacatggagttgatattacaaccagtgacactgcagggagaaatgctcttcacctggctgctaagtatggacatgcattgtgcctacaaaaacttctacagtacaattgtcccactgagcatgcagacctgcagggaagaactgcacttcacgatgccgcaatggcagattgtccttctagcatacagctgctttgtgaccatggggcctctgtgaatgccaaagatgtagacgggcggacaccacttgttctggctactcagatgagtaggccaacaatatgtcaactgctgatagatagaggagcggatgttaattccagagacaaacaaaacagaactgccctcatgctaggttgcgaatatggttgcagagatgcagtagaagtcttaattaaaaatggtgctgatataagcttgctggatgcgcttggccatgatagttcttactatgcaagaattggtgacaatctggacattctaaccttgttgaagactgcatcggaaaataccaacaaagggagagaactttggaagaaagggccatctttgcaacagcgaaatttgacacacatgcaagatgaagtaaatgtgaagtcacatcagagggagcatcaaaatattcaggatttggagattgaaaatgaagatttgaaagagaggttgagaaaaattcagcaagaacaaagaatacttttggataaagtcaatggtttacagttacagctgaatgagagagaaaagctgaagtcccttttggcagctaaagaaaagcaacatgaagaaagcttaaggactattgaggctctgaaaaatagatttaaatattttgagagtgatcatttaggatcaggaagtcatttcagtaaccgaaaagaagatatgcttcttaaacaaggtcagatgtatatggcagactcacagtgtacttccccaggtataccagcccatatgcaaagcagatctatgttaagacctctggaactatctttacccagtcaaacgtcatactctgaaaatgaaattttaaagaaagagttagaagcaatgcgaactttctgtgagtcagcaaaacaagaccgactgaagctccaaaatgaactggcacacaaagtggcagaatgcaaagctttagcattagaatgtgaaagggtcaaggaggattcagatgaacagataaagcaattagaagatgcattaaaagatgtgcagaagaggatgtatgagtcagaaggtaaagttaaacaaatgcagacccattttcttgcccttaaagaacacttaacaagtgaagcagcctcagggaatcacagactaaccgaggaactgaaggatcagttgaaagacttgaaagtaaaatatgaaggtgcttcagcagaagtggggaaattaagaaaccaaatcaaacaaaatgagatgatagtagaagagtttaagagggatgaaggcaagctgatagaagaaaataagcgattacagaaggaacttagtatgtgtgaaatggagcgagagaagaaaggaagaaaggtcacagagatggaaggccaggcaaaagaattgtcagcgaagttggccctttccattccagctgaaaaatttgaaaacatgaagagctcattatcaaatgaagtgaatgagaaagcaaaaaaattagtagaaatggaaagagaacatgaaaaatcacttagtgaaattagacagttaaagagagaacttgagaatgttaaggccaagcttgctcagcacgtcaaaccagaggaacatgaacaggttaagagcagattagaacagaaatcaggagaacttgggaagaagatcactgagttaacattgaaaaatcagacactacaaaaggaaattgaaaaagtttatttggataataagctcctcaaggagcaagcacataacttaacaattgaaatgaaaaatcattatgttcctttaaaagtaagtgaagacatgaaaaagtcacatgatgcaattattgatgatcttaatagaaagcttttagatgtaacacaaaaatatacagaaaagaagttggaaatggagaaattgctactggaaaatgacagcttaagtaaggatgtaagccgcctagaaactgtgtttgtacctcctgagaaacatgaaaaagagataatagctctgaaatccaatattgttgaacttaagaaacagctgtctgaacttaagaaaaaatgtggtgaagaccaggagaaaatacacgctctcacatctgaaaacactaacttgaagaagatgatgagtaatcagtatgtgccagttaaaacccatgaagaggttaaaatgacactgaatgacacgttagccaaaactaacagagaattattagatgtgaagaaaaaatttgaagatataaatcaggaatttgtaaaaataaaagataagaatgaaatattaaaaagaaacctggaaaacactcagaaccaaataaaagctgagtacatcagcctggcagagcacgaggcaaagatgagctcgctaagtcagagcatgagaaaggtgcaggatagtaatgctgaaatcttggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaaagcccagaagaaggagctcgacacaatacaagaatgcattaaggtaaaatacgccccaattgtcagctttgaggagtgcgagagaaaatttaaagcaacagagaaagaactaaaagaccagttatcagagcagacacaaaagtatagtgtcagtgaagaagaagtcaagaaaaacaagcaagagaatgacaagttaaagaaggagatttttacccttcagaaagatttgagagataagacagttctcattgagaagtctcatgaaatggaaagagcattaagcagaaaaacagacgagctaaacaaacagttaaaagacttgtcacagaaatacacggaagtaaagaatgtgaaagagaagctagtagaagaaaatgccaaacagacttctgagatacttgcagtgcaaaatcttttgcaaaaacaacatgttccattggaacaggttgaggctctgaaaaaatctcttaatggcacaattgaaaatctaaaggaagaactgaagagtatgcaaaggtgttacgagaaagagcagcagacagtgaccaaactgcatcaattgttggagaatcaaaagaactcttctgtacccctggcagagcatttgcagattaaagaagcatttgagaaagaagttggaatcataaaagccagcttgagagaaaaggaagaagaaagccaaaacaaaatggaagaagtctccaaacttcagtcggaggttcagaatactaaacaagcattaaaaaaattagagactagagaggtagttgacttgtctaaatataaagcaacaaaaagtgatttggagacacagatttctagcttaaatgaaaaattggccaatctgaatagaaagtatgaggaagtatgtgaggaagttttgcatgccaaaaagaaggaaatatctgcaaaagatgagaaggaattactgcatttcagcattgagcaagaaattaaggatcagaaggaacgatgtgataagtccttaacaacaatcacagagttacaaagaagaatacaagaatctgctaaacaaatagaagcaaaagataataagataactgaactgcttaatgatgtggaaagattaaaacaggcactcaatggcctttcccaactcacctacacaagtgggaaccccaccaagaggcagagccagctgattgacactctgcagcaccaagtgaaatctctggagcaacagctggccgatgctgacagacagcaccaagaagtaattgcaatttatcggacacaccttcttagtgctgcacagggtcacatggatgaagatgttcaggaggctctgctccagatcatacaaatgcggcaggggcttgtgtgctagccgttagcactgactgccagtatctgttttatcttgctggtgctgaacattctttgtgcaactccatggtctttctgggccttactgtgctggtataattaaaataaaatatattttgttcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]