GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:35:08, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_011512213            6793 bp    mRNA    linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens GRIP and coiled-coil domain containing 2
            (GCC2), transcript variant X3, mRNA.
ACCESSION   XM_011512213
VERSION     XM_011512213.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000002.12) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 6, 2016 this sequence version replaced XM_011512213.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6793
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
     gene            1..6793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="GRIP and coiled-coil domain containing 2; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 mRNA, 158 ESTs, 382 long SRA reads, 1 Protein, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments, including 34 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
     variation       7
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762716526"
     variation       9
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763945167"
     variation       12
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751176347"
     variation       13
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756879556"
     variation       21
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767161895"
     variation       25
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148209837"
     variation       27
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755657988"
     variation       29
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558723991"
     variation       31
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779609657"
     variation       33
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748649753"
     variation       44
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758752266"
     variation       45
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207685229"
     variation       55
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778128596"
     variation       57
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747208337"
     variation       60
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483211892"
     variation       62..64
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:775192400"
     variation       62
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421334437"
     variation       63
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771135360"
     variation       65
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199533705"
     variation       66
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1036704795"
     variation       70
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373516510"
     variation       74
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456640622"
     variation       75
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745986904"
     variation       78
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769852533"
     variation       82
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242173002"
     variation       90
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238971122"
     variation       95
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765998564"
     variation       96
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542695116"
     variation       100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424611167"
     variation       108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469285419"
     variation       113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763398963"
     variation       121
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211565025"
     variation       122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73954346"
     variation       124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202021546"
     variation       128
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178652122"
     variation       129
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553434715"
     variation       130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250962904"
     variation       133..140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggaactgg"
                     /db_xref="dbSNP:776439377"
     variation       137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757686298"
     variation       140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:894902332"
     variation       142
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374437665"
     variation       155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178718870"
     variation       158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441173043"
     variation       162
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292492321"
     variation       165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047137238"
     variation       166
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750749487"
     variation       167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202134489"
     variation       169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866210165"
     variation       171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780376350"
     variation       173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142334581"
     variation       174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113579201"
     variation       176
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199929849"
     variation       177..185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tcttct"
                     /replace="tcttcttct"
                     /db_xref="dbSNP:758868824"
     variation       181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216506062"
     variation       183
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487321871"
     variation       184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939935158"
     variation       188
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275288913"
     variation       190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755149519"
     variation       192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778787954"
     variation       205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1431387786"
     variation       208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558737751"
     variation       209
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200468428"
     variation       214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894344412"
     variation       219
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748107883"
     variation       221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187652885"
     variation       223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263041888"
     variation       224
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240014258"
     variation       227
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772082347"
     variation       232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777741289"
     variation       233
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169837227"
     variation       236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746838759"
     variation       237
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558737795"
     variation       240
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461681625"
     variation       245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919910894"
     variation       248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163590196"
     variation       250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347643379"
     variation       258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390294066"
     variation       261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:991958766"
     variation       282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316305305"
     variation       283
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772547354"
     variation       284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340895001"
     variation       285..291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:367799733"
     variation       287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401343586"
     variation       288
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558737980"
     variation       296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868736677"
     variation       297
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1375721086"
     variation       299
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766165187"
     variation       300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285457452"
     variation       302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376738248"
     CDS             307..5025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /codon_start=1
                     /product="GRIP and coiled-coil domain-containing protein 2
                     isoform X3"
                     /protein_id="XP_011510515.1"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
                     /translation="
MGDAHKELEQSHINYVKEIENLKNELMAVRSKYSEDKANLQKQLEEAMNTQLELSEQLKFQNNSEDNVKKLQEEIEKIRPGFEEQILYLQKQLDATTDEKKETVTQLQNIIEANSQHYQKNINSLQEELLQLKAIHQEEVKELMCQIEASAKEHEAEINKLNELKENLVKQCEASEKNIQKKYECELENLRKATSNANQDNQICSILLQENTFVEQVVNEKVKHLEDTLKELESQHSILKDEVTYMNNLKLKLEMDAQHIKDEFFHEREDLEFKINELLLAKEEQGCVIEKLKSELAGLNKQFCYTVEQHNREVQSLKEQHQKEISELNETFLSDSEKEKLTLMFEIQGLKEQCENLQQEKQEAILNYESLREIMEILQTELGESAGKISQEFESMKQQQASDVHELQQKLRTAFTEKDALLETVNRLQGENEKLLSQQELVPELENTIKNLQEKNGVYLLSLSQRDTMLKELEGKINSLTEEKDDFINKLKNSHEEMDNFHKKCEREERLILELGKKVEQTIQYNSELEQKVNELTGGLEETLKEKDQNDQKLEKLMVQMKVLSEDKEVLSAEVKSLYEENNKLSSEKKQLSRDLEVFLSQKEDVILKEHITQLEKKLQLMVEEQDNLNKLLENEQVQKLFVKTQLYGFLKEMGSEVSEDSEEKDVVNVLQAVGESLAKINEEKCNLAFQRDEKVLELEKEIKCLQEESVVQCEELKSLLRDYEQEKVLLRKELEEIQSEKEALQSDLLEMKNANEKTRLENQNLLIQVEEVSQTCSKSEIHNEKEKCFIKEHENLKPLLEQKELRDRRAELILLKDSLAKSPSVKNDPLSSVKELEEKIENLEKECKEKEEKINKIKLVAVKAKKELDSSRKETQTVKEELESLRSEKDQLSASMRDLIQGAESYKNLLLEYEKQSEQLDVEKERANNFEHRIEDLTRQLRNSTLQCETINSDNEDLLARIETLQSNAKLLEVQILEVQRAKAMVDKELEAEKLQKEQKIKEHATTVNELEELQVQLQKQKKQLQKTMQELELVKKDAQQTTLMNMEIADYERLMKELNQKLTNKNNKIEDLEQEIKIQKQKQETLQEEITSLQSSVQQYEEKNTKIKQLLVKTKKELADSKQAETDHLILQASLKGELEASQQQVEVYKIQLAEITSEKHKIHEHLKTSAEQHQRTLSAYQQRVTALQEECRAAKAEQATVTSEFESYKVRVHNVLKQQKNKSMSQAETEGAKQEREHLEMLIDQLKIKLQDSQNNLQINVSELQTLQSEHDTLLERHNKMLQETVSKEAELREKLCSIQSENMMMKSEHTQTVSQLTSQNEVLRNSFRDQVRHLQEEHRKTVETLQQQLSKMEAQLFQLKNEPTTRSPVSSQQSLKNLRERRNTDLPLLDMHTVTREEGEGMETTDTESVSSASTYTQSLEQLLNSPETKLEPPLWHAEFTKEELVQKLSSTTKSADHLNGLLRETEATNAILMEQIKLLKSEIRRLERNQEREKSAANLEYLKNVLLQFIFLKPGSERERLLPVINTMLQLSPEEKGKLAAVAQGEEENASRSSGWASYLHSWSGLR"
     misc_feature    <322..2829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="Chromosome segregation ATPase [Cell cycle control,
                     cell division, chromosome partitioning]; Region: Smc;
                     COG1196"
                     /db_xref="CDD:224117"
     misc_feature    2068..4404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     misc_feature    4612..4806
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="Rab binding domain; Region: Rab_bind; pfam16704"
                     /db_xref="CDD:293309"
     misc_feature    4810..4938
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="GRIP domain; Region: GRIP; pfam01465"
                     /db_xref="CDD:279767"
     variation       308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213677786"
     variation       310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746930580"
     variation       313
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757141762"
     variation       315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370827700"
     variation       319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368534626"
     variation       324
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769292941"
     variation       330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372290189"
     variation       331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748848872"
     variation       336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768145104"
     variation       341
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141520578"
     variation       343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159766911"
     variation       347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761016613"
     variation       348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413708133"
     variation       351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766775912"
     variation       353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938366734"
     variation       355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776808644"
     variation       358..359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35216570"
     variation       358
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478498128"
     variation       361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308744812"
     variation       362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868566268"
     variation       367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374790581"
     variation       377
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026821005"
     variation       379
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262474465"
     variation       381
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759830991"
     variation       389
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318255064"
     variation       392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765415439"
     variation       394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373554463"
     variation       395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915570315"
     variation       397
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284739793"
     variation       401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1171350569"
     variation       407
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758608147"
     variation       408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1438722532"
     variation       411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1198919570"
     variation       414
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237141922"
     variation       416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456081578"
     variation       420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764264510"
     variation       421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751556782"
     variation       422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752749562"
     variation       426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558738514"
     variation       431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912540674"
     variation       438
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377697070"
     variation       440
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757094933"
     variation       442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305338654"
     variation       444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903042861"
     variation       446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170704241"
     variation       448
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781073297"
     variation       455
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745692153"
     variation       456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755917409"
     variation       458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779742639"
     variation       465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748938912"
     variation       472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768163382"
     variation       478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330573150"
     variation       483
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773788157"
     variation       487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747569256"
     variation       493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340529074"
     variation       495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218346299"
     variation       497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769277550"
     variation       501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771300150"
     variation       504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759864429"
     variation       508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201591332"
     variation       509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775920739"
     variation       517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763201366"
     variation       519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243715943"
     variation       522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:539963771"
     variation       525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150351597"
     variation       529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751554456"
     variation       530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208830244"
     variation       532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421189786"
     variation       535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264689418"
     variation       536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761923647"
     variation       540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767406173"
     variation       549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390150348"
     variation       553..554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttacagaatcct"
                     /db_xref="dbSNP:1385104343"
     variation       557
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552450339"
     variation       558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755932248"
     variation       562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779761244"
     variation       567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753498571"
     variation       568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337362392"
     variation       575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246568389"
     variation       579
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265610795"
     variation       581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296769383"
     variation       584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216625830"
     variation       588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367729142"
     variation       589
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778423603"
     variation       590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007980786"
     variation       596
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017594058"
     variation       597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649752"
     variation       600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371673633"
     variation       603
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771587101"
     variation       605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781607007"
     variation       607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746381453"
     variation       611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758253345"
     variation       614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043247481"
     variation       615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775949291"
     variation       621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763300179"
     variation       624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443343409"
     variation       627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430018040"
     variation       635
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564390284"
     variation       638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761858711"
     variation       639
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899169070"
     variation       641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357778821"
     variation       648
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767632667"
     variation       650
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927482380"
     variation       655
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339571489"
     variation       659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215840563"
     variation       662..668
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:755348339"
     variation       662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:994906398"
     variation       667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242140413"
     variation       669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1310875966"
     variation       670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937580013"
     variation       680
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750335313"
     variation       681
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057397524"
     variation       683
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283738431"
     variation       685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774722092"
     variation       687
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200754713"
     variation       696
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255214947"
     variation       699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766179585"
     variation       707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375071388"
     variation       709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753586906"
     variation       712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149070749"
     variation       713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439107634"
     variation       717
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157395042"
     variation       723
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583148"
     variation       725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752379605"
     variation       727
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757912028"
     variation       732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376279109"
     variation       735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302682243"
     variation       738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746374412"
     variation       740
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756649080"
     variation       742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385557146"
     variation       744
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761892796"
     variation       746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749721042"
     variation       747
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463390892"
     variation       748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306999754"
     variation       750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76646082"
     variation       753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233867129"
     variation       756
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558738932"
     variation       758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255245986"
     variation       759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482138219"
     variation       761
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774507288"
     variation       765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238954303"
     variation       766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386969618"
     variation       767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748339477"
     variation       772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1250880284"
     variation       772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178546900"
     variation       775..795
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gag"
                     /replace="gagataaataagttgaacgag"
                     /db_xref="dbSNP:1176920721"
     variation       775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772062666"
     variation       777
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773289345"
     variation       782..784
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1175935875"
     variation       782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760633335"
     variation       786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766341042"
     variation       789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452090498"
     variation       792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776525647"
     variation       793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400490790"
     variation       794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445578874"
     variation       796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328763222"
     variation       798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382284"
     variation       802
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765075262"
     variation       804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546753702"
     variation       805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310228623"
     variation       807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220165389"
     variation       808
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284425608"
     variation       810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763543965"
     variation       813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376224425"
     variation       814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756806500"
     variation       817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186410906"
     variation       818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385284172"
     variation       820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558739067"
     variation       821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755402448"
     variation       825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779282384"
     variation       830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748344811"
     variation       834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200408782"
     variation       837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171917691"
     variation       844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558739092"
     variation       845..851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:781322684"
     variation       855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423342495"
     variation       859
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773271826"
     variation       861
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201596826"
     variation       862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924360145"
     variation       864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553682391"
     variation       865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457914246"
     variation       866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770983017"
     variation       868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776615615"
     variation       872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759400747"
     variation       883
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764953975"
     variation       893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775306593"
     variation       896
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217067767"
     variation       898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624813"
     variation       900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763857256"
     variation       901
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220842965"
     variation       902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263757051"
     variation       903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:934492136"
     variation       910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051570715"
     variation       915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489590964"
     variation       916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751245972"
     variation       917
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535556399"
     variation       918
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477025570"
     variation       920
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184415942"
     variation       922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200042988"
     variation       923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202061636"
     variation       925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755468422"
     variation       938
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741176"
     variation       939
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753141947"
     variation       941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758664500"
     variation       942
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539887315"
     variation       944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397845853"
     variation       954
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351554396"
     variation       955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747229762"
     variation       956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380239386"
     variation       958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771005293"
     variation       960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781192585"
     variation       962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262588948"
     variation       965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141977454"
     variation       966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218012387"
     variation       972
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769810605"
     variation       974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405402526"
     variation       976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400602749"
     variation       984
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487522778"
     variation       985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775266412"
     variation       986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1347129199"
     variation       989
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558193053"
     variation       992
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558739320"
     variation       999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729897"
     variation       1005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180903332"
     variation       1011
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774149480"
     variation       1013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199925996"
     variation       1016
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159186035"
     variation       1018
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767153817"
     variation       1027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927437409"
     variation       1028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749908800"
     variation       1029
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336007488"
     variation       1033
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760076821"
     variation       1034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1297778289"
     variation       1037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765826004"
     variation       1040
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057519387"
     variation       1041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753133550"
     variation       1045
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758866357"
     variation       1046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481644642"
     variation       1060
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1421904421"
     variation       1063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993461340"
     variation       1064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778047476"
     variation       1073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751794952"
     variation       1076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757422255"
     variation       1077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781280877"
     variation       1080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746008880"
     variation       1082
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769748065"
     variation       1083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240810622"
     variation       1084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193332313"
     variation       1085
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534102235"
     variation       1086
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749110429"
     variation       1087
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768508067"
     variation       1091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774235989"
     variation       1096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761585182"
     variation       1098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198814494"
     variation       1109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574072336"
     variation       1116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048297594"
     variation       1123
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316857514"
     variation       1134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771895994"
     variation       1137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772980641"
     variation       1140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225559696"
     variation       1147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447793659"
     variation       1149
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949032983"
     variation       1150
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375856134"
     variation       1151..1158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1558739486"
     variation       1152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765805903"
     variation       1161
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369977320"
     variation       1163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374737591"
     variation       1172
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753254448"
     variation       1173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1326973625"
     variation       1177..1184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaattaaa"
                     /db_xref="dbSNP:752944414"
     variation       1180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281990243"
     variation       1187
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374813941"
     variation       1191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448662773"
     variation       1196
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344757214"
     variation       1197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393854068"
     variation       1202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404677344"
     variation       1203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764466155"
     variation       1205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260381807"
     variation       1215
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751881094"
     variation       1220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198848160"
     variation       1221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237083074"
     variation       1225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369170580"
     variation       1229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200948483"
     variation       1232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767784682"
     variation       1235
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746003"
     variation       1239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167702345"
     variation       1240..1244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1477651601"
     variation       1240
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197102034"
     variation       1241
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048154580"
     variation       1246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555252199"
     variation       1250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466384395"
     variation       1254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773384748"
     variation       1258..1260
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1394461749"
     variation       1258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1444139642"
     variation       1259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779938219"
     variation       1260
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004130499"
     variation       1263
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035232214"
     variation       1266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749267870"
     variation       1267
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006736114"
     variation       1271
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1331092618"
     variation       1272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754922343"
     variation       1274..1278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:756135294"
     variation       1279..1284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atatca"
                     /db_xref="dbSNP:1341495036"
     variation       1280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959784795"
     variation       1281..1284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atca"
                     /db_xref="dbSNP:1218883900"
     variation       1282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778958751"
     variation       1289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1157197068"
     variation       1292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257604297"
     variation       1293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1336881383"
     variation       1295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022524104"
     variation       1296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968390662"
     variation       1298
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211043257"
     variation       1302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748009845"
     variation       1304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760868283"
     variation       1305
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978383532"
     variation       1314..1326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaaaaa"
                     /replace="agaaaaagaaaaa"
                     /db_xref="dbSNP:777760783"
     variation       1318
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771983890"
     variation       1320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478004008"
     variation       1321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193224912"
     variation       1325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1553438402"
     variation       1326..1336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="attaa"
                     /replace="attaacattaa"
                     /db_xref="dbSNP:745790902"
     variation       1326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147654490"
     variation       1329
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772987604"
     variation       1331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746578708"
     variation       1337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1423349948"
     variation       1340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142684498"
     variation       1347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775957002"
     variation       1349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140818127"
     variation       1350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943194201"
     variation       1352
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038941538"
     variation       1353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920490239"
     variation       1354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930649631"
     variation       1357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190820622"
     variation       1359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146700196"
     variation       1360
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246499911"
     variation       1366
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047693033"
     variation       1367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762231999"
     variation       1369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145247044"
     variation       1371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978819011"
     variation       1380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377604308"
     variation       1383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149652536"
     variation       1385
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185517792"
     variation       1387..1393
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagcaag"
                     /db_xref="dbSNP:1488502523"
     variation       1387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215702024"
     variation       1391..1396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:771974664"
     variation       1396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766508161"
     variation       1397
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372937652"
     variation       1399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753899949"
     variation       1401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237970379"
     variation       1406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556272156"
     variation       1410
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442812086"
     variation       1414
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274881421"
     variation       1416..1418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:779888794"
     variation       1419
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381407477"
     variation       1420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419608695"
     variation       1421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779054955"
     variation       1422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748096672"
     variation       1425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758275416"
     variation       1426..1430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:1558739859"
     variation       1427
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777375176"
     variation       1428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334360314"
     variation       1429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746698287"
     variation       1430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770450276"
     variation       1431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776316287"
     variation       1432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745440605"
     variation       1442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183575645"
     variation       1444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373973137"
     variation       1451
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774841781"
     variation       1453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762248388"
     variation       1456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767889211"
     variation       1458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773406502"
     variation       1471
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460045507"
     variation       1473..1480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagtcaag"
                     /db_xref="dbSNP:746744919"
     variation       1473..1474
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1442513029"
     variation       1477..1478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:768578200"
     variation       1479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439677984"
     variation       1483
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761066885"
     variation       1485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200958316"
     variation       1486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754082179"
     variation       1491..1496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:776384329"
     variation       1492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200270126"
     variation       1493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765343878"
     variation       1495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205671661"
     variation       1496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332839102"
     variation       1500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752697494"
     variation       1502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758365184"
     variation       1503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304732223"
     variation       1508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257044582"
     variation       1514
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148359301"
     variation       1515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031375413"
     variation       1519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751351993"
     variation       1521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111527126"
     variation       1524
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370488160"
     variation       1527..1533
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcag"
                     /replace="gcagcag"
                     /db_xref="dbSNP:1200741086"
     variation       1527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528729535"
     variation       1529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745455759"
     variation       1538
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480328029"
     variation       1540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995115"
     variation       1542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769306376"
     variation       1545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434246089"
     variation       1553
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490121597"
     variation       1554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748202873"
     variation       1558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940939996"
     variation       1561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427602721"
     variation       1562..1603
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atg"
                     /replace="atgcccttctcgaaactgtgaatcgcctccagggagaaaatg"
                     /db_xref="dbSNP:1315005166"
     variation       1562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111613095"
     variation       1566
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467952366"
     variation       1567..1571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1558740067"
     variation       1572
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540949615"
     variation       1573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562126455"
     variation       1577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772493105"
     variation       1579
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352409978"
     variation       1582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176292274"
     variation       1585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377282558"
     variation       1586
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761006452"
     variation       1592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771325509"
     variation       1594
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346503661"
     variation       1596
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305544670"
     variation       1601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282438487"
     variation       1604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776999762"
     variation       1605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759778171"
     variation       1606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279003695"
     variation       1608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467723931"
     variation       1611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765431163"
     variation       1614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202595118"
     variation       1621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752787189"
     variation       1622
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489117399"
     variation       1630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763095072"
     variation       1632..1633
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1423397180"
     variation       1633
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763988821"
     variation       1634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175972132"
     variation       1636
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751509052"
     variation       1646
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195400958"
     variation       1651
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371790236"
     variation       1652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427539820"
     variation       1654
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167781340"
     variation       1663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780981207"
     variation       1665
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501385"
     variation       1667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302431416"
     variation       1671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363495038"
     variation       1675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755720124"
     variation       1676
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779646741"
     variation       1678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369626877"
     variation       1679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361609748"
     variation       1690..1699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agtc"
                     /replace="agtctcagtc"
                     /db_xref="dbSNP:761581032"
     variation       1691
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768195223"
     variation       1692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778213807"
     variation       1693
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019082050"
     variation       1694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245928069"
     variation       1705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290135176"
     variation       1706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489482701"
     variation       1707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747487244"
     variation       1708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771216512"
     variation       1709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222504208"
     variation       1710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485361240"
     variation       1712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1323747305"
     variation       1713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184380647"
     variation       1714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373780548"
     variation       1716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:964534174"
     variation       1719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759869953"
     variation       1720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162868458"
     variation       1731..1733
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:756971621"
     variation       1734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402462037"
     variation       1737
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383371246"
     variation       1738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770183232"
     variation       1740
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298626440"
     variation       1742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920522699"
     variation       1743
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428913746"
     variation       1748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733788"
     variation       1750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550791699"
     variation       1752
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470443354"
     variation       1753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010141859"
     variation       1760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377725944"
     variation       1764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356545280"
     variation       1768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774169009"
     variation       1772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200008152"
     variation       1774
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284064502"
     variation       1787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767246456"
     variation       1789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750255811"
     variation       1790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426501841"
     variation       1791
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773730114"
     variation       1792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371376562"
     variation       1799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143706341"
     variation       1811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747355682"
     variation       1814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753488471"
     variation       1818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754454908"
     variation       1819
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778431070"
     variation       1820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939317682"
     variation       1828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282502541"
     variation       1830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139691316"
     variation       1832
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753625999"
     variation       1834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757744857"
     variation       1836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178521867"
     variation       1837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398374320"
     variation       1838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407187260"
     variation       1840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895191613"
     variation       1843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781756304"
     variation       1847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948209315"
     variation       1850..1851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:769325355"
     variation       1856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373924982"
     variation       1860..1864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agtag"
                     /db_xref="dbSNP:1379176443"
     variation       1862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448191708"
     variation       1864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145077426"
     variation       1868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274371671"
     variation       1871..1875
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="caatc"
                     /db_xref="dbSNP:1216852012"
     variation       1871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770271101"
     variation       1873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221355978"
     variation       1881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741717"
     variation       1885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749469344"
     variation       1886
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024464817"
     variation       1888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260734243"
     variation       1891
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191279740"
     variation       1896
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761764768"
     variation       1899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329552835"
     variation       1902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031657685"
     variation       1904
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460307482"
     variation       1914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483560293"
     variation       1915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61739749"
     variation       1917..1923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agga"
                     /replace="aggagga"
                     /db_xref="dbSNP:772664758"
     variation       1919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891475133"
     variation       1921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740583"
     variation       1922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767490206"
     variation       1924
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773116841"
     variation       1928
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367881891"
     variation       1929
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411624165"
     variation       1933
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920857758"
     variation       1936..1939
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttaa"
                     /db_xref="dbSNP:1402557746"
     variation       1937..1941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="taaaa"
                     /db_xref="dbSNP:763502591"
     variation       1937
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182461304"
     variation       1938..1947
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaag"
                     /replace="aaaagaaaag"
                     /db_xref="dbSNP:766736753"
     variation       1943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353341747"
     variation       1948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439184703"
     variation       1951
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140310167"
     variation       1952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345221071"
     variation       1953
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766099385"
     variation       1955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555677090"
     variation       1958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740656"
     variation       1962
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576244953"
     variation       1966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764688075"
     variation       1972
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752293612"
     variation       1975
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436046060"
     variation       1978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757826462"
     variation       1979
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182645789"
     variation       1980
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372074612"
     variation       1981
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150938411"
     variation       1992
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749502433"
     variation       1993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475864400"
     variation       1994
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150078317"
     variation       1995
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394396750"
     variation       1996
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376990612"
     variation       2000
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304241885"
     variation       2006
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772129982"
     variation       2008..2013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:759852289"
     variation       2008..2010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:752109794"
     variation       2008
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226547497"
     variation       2013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403426657"
     variation       2014
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773135239"
     variation       2016
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141805666"
     variation       2017
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391057767"
     variation       2027..2028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:767887598"
     variation       2027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1269123750"
     variation       2028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369088854"
     variation       2033
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298541997"
     variation       2034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372865093"
     variation       2036
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200389027"
     variation       2040
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577283127"
     variation       2041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375946212"
     variation       2042
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759222318"
     variation       2051
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61741893"
     variation       2053..2057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:752891062"
     variation       2054
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764991505"
     variation       2061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762619155"
     variation       2066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945879082"
     variation       2069..2076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:756364486"
     variation       2069
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763638702"
     variation       2073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406749496"
     variation       2077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750989248"
     variation       2084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371440005"
     variation       2089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1473780638"
     variation       2097..2098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1164785165"
     variation       2098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558740890"
     variation       2099..2105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:777909420"
     variation       2103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776466243"
     variation       2105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780392284"
     variation       2111..2115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1160864211"
     variation       2111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754274589"
     variation       2112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186457569"
     variation       2114..2120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:553103180"
     variation       2118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779257690"
     variation       2119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748248613"
     variation       2122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772156346"
     variation       2123
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358697601"
     variation       2128
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777785198"
     variation       2131..2136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:757374682"
     variation       2134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259075581"
     variation       2138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368592749"
     variation       2140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770899061"
     variation       2141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372319248"
     variation       2148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776412280"
     variation       2152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759260339"
     variation       2155..2159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:779791241"
     variation       2157
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444328870"
     variation       2162..2163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1230076424"
     variation       2169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290111450"
     variation       2181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759436302"
     variation       2182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242578153"
     variation       2184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769472880"
     variation       2187..2191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="taatt"
                     /db_xref="dbSNP:746975961"
     variation       2189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364766321"
     variation       2203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553327544"
     variation       2210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762645439"
     variation       2212
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405508254"
     variation       2215
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992533570"
     variation       2216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741028"
     variation       2218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763728337"
     variation       2227..2231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttatt"
                     /db_xref="dbSNP:1392708707"
     variation       2230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138472765"
     variation       2231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761384692"
     variation       2232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916577022"
     variation       2236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364082251"
     variation       2238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381340267"
     variation       2244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766964266"
     variation       2249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750341029"
     variation       2251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336144112"
     variation       2257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1238134261"
     variation       2258..2259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1258733483"
     variation       2260..2266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaagaaa"
                     /db_xref="dbSNP:1055792867"
     variation       2266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325973107"
     variation       2268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755370564"
     variation       2272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260191310"
     variation       2273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779086346"
     variation       2274
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752942121"
     variation       2282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181053232"
     variation       2286
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251796166"
     variation       2289..2290
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="caa"
                     /db_xref="dbSNP:1419002672"
     variation       2290..2291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1382806587"
     variation       2296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758583225"
     variation       2297
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379714687"
     variation       2300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757883913"
     variation       2301
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741151"
     variation       2304..2310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /db_xref="dbSNP:768523280"
     variation       2304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948157020"
     variation       2306
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223836489"
     variation       2311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764900269"
     variation       2314
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376201616"
     variation       2316
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293344874"
     variation       2317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467722939"
     variation       2322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014322616"
     variation       2323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781259774"
     variation       2328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368499106"
     variation       2329
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540561575"
     variation       2335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347103200"
     variation       2336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558741197"
     variation       2340..2341
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1224383207"
     variation       2341
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147267352"
     variation       2348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749060582"
     variation       2352
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1321520535"
     variation       2355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768472292"
     variation       2363
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62000420"
     variation       2367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962155514"
     variation       2371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761471420"
     variation       2380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766868631"
     variation       2381
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777206295"
     variation       2384
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373358076"
     variation       2385
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480930422"
     variation       2388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199715610"
     variation       2392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765668476"
     variation       2395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377548265"
     variation       2397
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558741259"
     variation       2398
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293995034"
     variation       2399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263972654"
     variation       2402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774873391"
     variation       2405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181789592"
     variation       2411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479248738"
     variation       2416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202022886"
     variation       2418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964071112"
     variation       2420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461440891"
     variation       2422..2425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1296335720"
     variation       2427
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380536974"
     variation       2432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758744395"
     variation       2434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374201747"
     variation       2437
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751776542"
     variation       2440
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302288457"
     variation       2442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757364490"
     variation       2443
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052721221"
     variation       2445
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781076781"
     variation       2449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296418496"
     variation       2455
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1366183315"
     variation       2455
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745847876"
     variation       2458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306956276"
     variation       2460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147227525"
     variation       2461..2465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1558741343"
     variation       2464
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780117635"
     variation       2467
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294514823"
     variation       2469
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490652955"
     variation       2476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222296847"
     variation       2477
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749153398"
     variation       2478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367728508"
     variation       2480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741376"
     variation       2487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370623394"
     variation       2491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747741971"
     variation       2492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771631848"
     variation       2493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168245988"
     variation       2496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336979954"
     variation       2500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387071496"
     variation       2501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361987402"
     variation       2502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1040053435"
     variation       2503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560484"
     variation       2506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760204378"
     variation       2507..2512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agttag"
                     /db_xref="dbSNP:781183137"
     variation       2509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162752039"
     variation       2511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563097138"
     variation       2516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201325666"
     variation       2520..2522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:925811579"
     variation       2521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775964196"
     variation       2522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139623765"
     variation       2528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146256742"
     variation       2529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751795034"
     variation       2534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757380227"
     variation       2536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392507603"
     variation       2537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144062162"
     variation       2538
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894451722"
     variation       2539
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444078397"
     variation       2540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951929244"
     variation       2543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319064296"
     variation       2547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527733249"
     variation       2548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014683399"
     variation       2550..2555
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tct"
                     /replace="tcttct"
                     /db_xref="dbSNP:747772330"
     variation       2551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005083150"
     variation       2557
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485331180"
     variation       2560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536516536"
     variation       2561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186194933"
     variation       2562..2567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaa"
                     /replace="gaagaa"
                     /db_xref="dbSNP:1202843350"
     variation       2564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244424916"
     variation       2566
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567813236"
     variation       2567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149051213"
     variation       2568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749167273"
     variation       2570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243229382"
     variation       2580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200328829"
     variation       2582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014849447"
     variation       2583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778799262"
     variation       2584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747868838"
     variation       2585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451858435"
     variation       2591
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771664379"
     variation       2594
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777463225"
     variation       2598
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452583533"
     variation       2600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313471572"
     variation       2602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992073362"
     variation       2603..2606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1558741601"
     variation       2604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376001079"
     variation       2606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373019080"
     variation       2614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224741919"
     variation       2617..2623
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:769389279"
     variation       2620
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746562390"
     variation       2622..2625
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="agta"
                     /db_xref="dbSNP:772930314"
     variation       2625
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424149870"
     variation       2627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385964891"
     variation       2629
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775980873"
     variation       2631
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763395652"
     variation       2634..2635
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1182556330"
     variation       2634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993580082"
     variation       2643
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235725178"
     variation       2648
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027769388"
     variation       2652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769032581"
     variation       2654
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916608229"
     variation       2655
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406948239"
     variation       2659..2670
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaaaaa"
                     /replace="gaaaaagaaaaa"
                     /db_xref="dbSNP:1471744452"
     variation       2661
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178798839"
     variation       2665
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774737186"
     variation       2671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762213492"
     variation       2685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374523392"
     variation       2690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1490152565"
     variation       2694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750652114"
     variation       2695
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151131536"
     variation       2697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766504781"
     variation       2700
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567509759"
     variation       2705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147113988"
     variation       2710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284743129"
     variation       2715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322611947"
     variation       2720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778966752"
     variation       2725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222443730"
     variation       2726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751461574"
     variation       2731..2735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1439543677"
     variation       2735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205071225"
     variation       2737
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902683816"
     variation       2738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481909936"
     variation       2739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371074235"
     variation       2745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:925335557"
     variation       2746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777356661"
     variation       2747
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746606214"
     variation       2748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029375087"
     variation       2751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142522262"
     variation       2752
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780634068"
     variation       2753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366658848"
     variation       2758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748627738"
     variation       2761
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769572125"
     variation       2762
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772341027"
     variation       2764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138827624"
     variation       2765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771330093"
     variation       2766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933489795"
     variation       2767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362992732"
     variation       2768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775165071"
     variation       2774
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248048275"
     variation       2779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182216335"
     variation       2780
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144683999"
     variation       2781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1292269123"
     variation       2785
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188078487"
     variation       2788
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776983164"
     variation       2790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759759979"
     variation       2795..2798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1208301358"
     variation       2799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286683427"
     variation       2801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249613038"
     variation       2803
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765298197"
     variation       2805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558742437"
     variation       2807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965465988"
     variation       2808..2811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1417198054"
     variation       2808
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304894"
     variation       2814..2818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gttgg"
                     /db_xref="dbSNP:1246244416"
     variation       2815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042628793"
     variation       2819..2820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1447003740"
     variation       2821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184707117"
     variation       2829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762900631"
     variation       2831
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761600051"
     variation       2832
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260851474"
     variation       2838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218124658"
     variation       2840..2844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1251727905"
     variation       2840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767241149"
     variation       2841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184094290"
     variation       2845..2849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gaatg"
                     /db_xref="dbSNP:981067132"
     variation       2845
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750094291"
     variation       2847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751037716"
     variation       2848
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234487157"
     variation       2855..2856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1480106752"
     variation       2857..2859
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1409395750"
     variation       2859
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182135420"
     variation       2863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755719987"
     variation       2865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765913754"
     variation       2868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1464512757"
     variation       2872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197336886"
     variation       2873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753434393"
     variation       2874
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374554854"
     variation       2878
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370690279"
     variation       2892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754436218"
     variation       2893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778414438"
     variation       2894
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775133111"
     variation       2898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741301"
     variation       2899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201533301"
     variation       2901..2910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaagaa"
                     /replace="aaagaaagaa"
                     /db_xref="dbSNP:1379177165"
     variation       2904
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300703183"
     variation       2909
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310476331"
     variation       2914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230280873"
     variation       2916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540350740"
     variation       2918
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770097002"
     variation       2919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749450889"
     variation       2933
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804002"
     variation       2934
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778920396"
     variation       2936
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748191151"
     variation       2941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772043861"
     variation       2945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369476264"
     variation       2947
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163802954"
     variation       2949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478364800"
     variation       2958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348399041"
     variation       2959
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773117197"
     variation       2960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760588617"
     variation       2961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770568579"
     variation       2965
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1481167189"
     variation       2966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776363038"
     variation       2968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764871527"
     variation       2970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200632066"
     variation       2971..2978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ga"
                     /replace="gaaaagga"
                     /db_xref="dbSNP:1294024072"
     variation       2975
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963686194"
     variation       2976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775180642"
     variation       2978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992064468"
     variation       2986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373531562"
     variation       2989
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228174598"
     variation       2994
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310983408"
     variation       2995
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:974061040"
     variation       3000
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768202885"
     variation       3001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756514438"
     variation       3003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199582186"
     variation       3005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400799163"
     variation       3007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766603690"
     variation       3010
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333097633"
     variation       3022
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463993580"
     variation       3023
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015529394"
     variation       3025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754116992"
     variation       3026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112414104"
     variation       3037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765508224"
     variation       3038
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752852118"
     variation       3042
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402766997"
     variation       3051
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200698017"
     variation       3052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345028400"
     variation       3059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218593126"
     variation       3060
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276494505"
     variation       3061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309185054"
     variation       3072
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043026548"
     variation       3073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423737921"
     variation       3074
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777666786"
     variation       3077..3081
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1173525178"
     variation       3081
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250765827"
     variation       3085
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746999034"
     variation       3086
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145961164"
     variation       3089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745710611"
     variation       3100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769643756"
     variation       3102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748897129"
     variation       3103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768308979"
     variation       3105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773774486"
     variation       3106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199920630"
     variation       3107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139373750"
     variation       3109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777189992"
     variation       3110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325051408"
     variation       3111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558748773"
     variation       3123
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961545411"
     variation       3124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331317699"
     variation       3128..3133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aattaa"
                     /db_xref="dbSNP:1297922376"
     variation       3132..3136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:755939952"
     variation       3132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759901263"
     variation       3138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369977045"
     variation       3140
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765528847"
     variation       3141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752940087"
     variation       3146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008229275"
     variation       3149
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273683937"
     variation       3152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161025040"
     variation       3163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763285911"
     variation       3170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1166742035"
     variation       3172..3177
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:1462193829"
     variation       3173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760393036"
     variation       3175..3179
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ga"
                     /replace="gaaga"
                     /db_xref="dbSNP:1319298198"
     variation       3182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764284016"
     variation       3188
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397662496"
     variation       3190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150549327"
     variation       3191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761805619"
     variation       3192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767581549"
     variation       3194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139867631"
     variation       3199
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750413831"
     variation       3205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1196396069"
     variation       3207
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400697261"
     variation       3219..3225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atta"
                     /replace="attatta"
                     /db_xref="dbSNP:1558749221"
     variation       3220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762166594"
     variation       3223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766073111"
     variation       3225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266296314"
     variation       3229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271461409"
     variation       3237
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385757799"
     variation       3239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326304266"
     variation       3243
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231267860"
     variation       3244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271988906"
     variation       3248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370403999"
     variation       3249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333849411"
     variation       3252
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780117653"
     variation       3262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141225250"
     variation       3263
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978616285"
     variation       3264
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540191458"
     variation       3268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778432512"
     variation       3269
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561373947"
     variation       3275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450117592"
     variation       3285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1472695864"
     variation       3287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771506645"
     variation       3292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777225487"
     variation       3295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746492141"
     variation       3297
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173033029"
     variation       3303
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770339104"
     variation       3304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775966369"
     variation       3306
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112143014"
     variation       3308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309592184"
     variation       3317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1302222404"
     variation       3318
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249329980"
     variation       3320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387197812"
     variation       3323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772479486"
     variation       3324
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209968900"
     variation       3325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773563468"
     variation       3326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766506745"
     variation       3329
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112971525"
     variation       3331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759479296"
     variation       3339
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448704314"
     variation       3340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440973448"
     variation       3343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166476755"
     variation       3345
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765054604"
     variation       3349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190032468"
     variation       3351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238462585"
     variation       3354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752586160"
     variation       3355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758118731"
     variation       3357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361037016"
     variation       3360
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388586464"
     variation       3361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763805735"
     variation       3364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751148636"
     variation       3369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756776491"
     variation       3370
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2718698"
     variation       3373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315251271"
     variation       3379
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776376279"
     variation       3381
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764254276"
     variation       3382
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142611820"
     variation       3388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414857869"
     variation       3392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755553644"
     variation       3394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260090078"
     variation       3395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533881757"
     variation       3396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779270856"
     variation       3402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1458299039"
     variation       3403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748611623"
     variation       3406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151289779"
     variation       3409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778153215"
     variation       3412
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747178123"
     variation       3415
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1415631486"
     variation       3416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424647828"
     variation       3421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1325419433"
     variation       3424
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312668795"
     variation       3426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761579405"
     variation       3429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277861717"
     variation       3435
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767262699"
     variation       3439
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749975866"
     variation       3442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760245435"
     variation       3446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765755225"
     variation       3456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192991650"
     variation       3469
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426537811"
     variation       3470
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753276945"
     variation       3472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172190231"
     variation       3475
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372757727"
     variation       3480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759015773"
     variation       3488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927576463"
     variation       3492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150423177"
     variation       3495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142777791"
     variation       3496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439441831"
     variation       3504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276083510"
     variation       3508..3515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aacaa"
                     /replace="aacaacaa"
                     /db_xref="dbSNP:746365647"
     variation       3512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303050399"
     variation       3513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143737097"
     variation       3516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781485417"
     variation       3517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005737514"
     variation       3520
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300981933"
     variation       3521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343962219"
     variation       3529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202439691"
     variation       3535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866490440"
     variation       3537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205597910"
     variation       3541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746022977"
     variation       3544
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039516171"
     variation       3545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756242710"
     variation       3546
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779960812"
     variation       3547..3554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="caaaaaca"
                     /db_xref="dbSNP:1558750723"
     variation       3553
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749344356"
     variation       3555
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375968480"
     variation       3561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423306291"
     variation       3562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965819512"
     variation       3566
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774263627"
     variation       3567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456568396"
     variation       3568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747941337"
     variation       3573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168319647"
     variation       3574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418410717"
     variation       3577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279630183"
     variation       3580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753889331"
     variation       3581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340034632"
     variation       3582..3583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:760543706"
     variation       3584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383278698"
     variation       3587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164577647"
     variation       3588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371419991"
     variation       3592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748029412"
     variation       3594
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162137907"
     variation       3599
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390811870"
     variation       3601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439976770"
     variation       3603..3609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1026397447"
     variation       3605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771930600"
     variation       3608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201741171"
     variation       3610
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746798568"
     variation       3614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770550098"
     variation       3617..3623
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:760884932"
     variation       3619
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776419181"
     variation       3623
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334403676"
     variation       3624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759122367"
     variation       3625
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558751667"
     variation       3631
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764785824"
     variation       3632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762189707"
     variation       3636
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768039941"
     variation       3643
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260097871"
     variation       3646
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369363942"
     variation       3649..3652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1409085692"
     variation       3653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371706600"
     variation       3657
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376460288"
     variation       3660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237737956"
     variation       3661
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474665198"
     variation       3663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766588884"
     variation       3664
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753998058"
     variation       3666..3667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1457709646"
     variation       3667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306024671"
     variation       3668
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157870118"
     variation       3671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368958563"
     variation       3678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369747246"
     variation       3682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334538821"
     variation       3684
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762300159"
     variation       3687
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759793368"
     variation       3694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765421952"
     variation       3705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234557370"
     variation       3707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050094389"
     variation       3708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1303138344"
     variation       3711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752777880"
     variation       3725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418859139"
     variation       3734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201346948"
     variation       3739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888743151"
     variation       3744
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276418795"
     variation       3748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480741796"
     variation       3750
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203441758"
     variation       3754
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277281384"
     variation       3757..3760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1483652197"
     variation       3757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194756808"
     variation       3758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376638817"
     variation       3763
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388589708"
     variation       3764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1348990551"
     variation       3772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779584230"
     variation       3778
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533500477"
     variation       3779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010946455"
     variation       3782..3786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="catca"
                     /db_xref="dbSNP:1051912718"
     variation       3782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332631187"
     variation       3785
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754477036"
     variation       3793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778523077"
     variation       3794
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485455575"
     variation       3800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021365021"
     variation       3801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031269477"
     variation       3802
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404396524"
     variation       3803
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346459110"
     variation       3804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747634829"
     variation       3805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144078912"
     variation       3807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111823638"
     variation       3808
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41280574"
     variation       3813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457744633"
     variation       3818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954168656"
     variation       3821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548223516"
     variation       3822
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414066111"
     variation       3823
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770087901"
     variation       3824
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147550431"
     variation       3825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763198265"
     variation       3827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452133427"
     variation       3829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304934172"
     variation       3834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380914128"
     variation       3836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444883031"
     variation       3838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985615983"
     variation       3839
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369984459"
     variation       3840..3855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tac"
                     /replace="tacgctaagtgcatac"
                     /db_xref="dbSNP:1558752584"
     variation       3842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774543551"
     variation       3843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149849446"
     variation       3850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767562609"
     variation       3851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345819253"
     variation       3852
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1284954649"
     variation       3855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750323927"
     variation       3858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755993632"
     variation       3862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1061202"
     variation       3863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257498831"
     variation       3865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766154317"
     variation       3866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210366792"
     variation       3874
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753544225"
     variation       3877
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249531562"
     variation       3879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754707101"
     variation       3881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177816192"
     variation       3882
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373111221"
     variation       3883
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747724362"
     variation       3885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449777234"
     variation       3888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178735235"
     variation       3889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567930302"
     variation       3890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918884510"
     variation       3892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929060807"
     variation       3893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377405233"
     variation       3897
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746326735"
     variation       3902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206287208"
     variation       3904
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374497002"
     variation       3907
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148977033"
     variation       3915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407752377"
     variation       3916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776365638"
     variation       3920
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368522198"
     variation       3925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440025107"
     variation       3927
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034665624"
     variation       3930
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141270164"
     variation       3931
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327923712"
     variation       3947
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431185464"
     variation       3948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959267073"
     variation       3950
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752379912"
     variation       3951
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762637740"
     variation       3952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036170628"
     variation       3953
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763715849"
     variation       3958
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751132179"
     variation       3961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756721047"
     variation       3967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780621282"
     variation       3975..3982
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaat"
                     /replace="aaataaat"
                     /db_xref="dbSNP:1364076790"
     variation       3977
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144995786"
     variation       3980
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755398917"
     variation       3983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867744399"
     variation       3984..3986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1447137543"
     variation       3984
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474192067"
     variation       3985
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537417442"
     variation       3986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748498789"
     variation       3994
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460872821"
     variation       3996
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772479263"
     variation       3998
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:915000290"
     variation       4003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141811180"
     variation       4005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770858790"
     variation       4006
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776653662"
     variation       4007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188112234"
     variation       4008
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759353170"
     variation       4009
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769689840"
     variation       4015
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1553442136"
     variation       4028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373591045"
     variation       4037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280652233"
     variation       4039
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769785023"
     variation       4041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775406077"
     variation       4044..4047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgac"
                     /db_xref="dbSNP:1396995824"
     variation       4049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768387950"
     variation       4057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420302565"
     variation       4061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175646405"
     variation       4063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048526317"
     variation       4065
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762001026"
     variation       4066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761409091"
     variation       4069
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:889959359"
     variation       4071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455451585"
     variation       4077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767174442"
     variation       4080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394727280"
     variation       4087
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201598096"
     variation       4092
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760256265"
     variation       4095
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765843796"
     variation       4098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939766734"
     variation       4100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1390875585"
     variation       4101
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212522497"
     variation       4105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753198031"
     variation       4107
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372100844"
     variation       4109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442166911"
     variation       4110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12104502"
     variation       4113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895614689"
     variation       4119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280481528"
     variation       4125
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226027616"
     variation       4126
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751922360"
     variation       4127
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901467304"
     variation       4132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550647621"
     variation       4133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781465261"
     variation       4135
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569137853"
     variation       4137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194705666"
     variation       4138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773834644"
     variation       4141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779983908"
     variation       4145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044734650"
     variation       4146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904420878"
     variation       4148..4154
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1484081118"
     variation       4148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000234141"
     variation       4151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749179357"
     variation       4152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143480889"
     variation       4155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200823043"
     variation       4156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031666308"
     variation       4157
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774060667"
     variation       4158
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747959489"
     variation       4161
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370787694"
     variation       4163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772853681"
     variation       4167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325657570"
     variation       4168
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532944652"
     variation       4170..4174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:771577824"
     variation       4171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761073703"
     variation       4173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213272486"
     variation       4184
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558755166"
     variation       4185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373039945"
     variation       4186
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1326630594"
     variation       4187
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776172312"
     variation       4192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201191345"
     variation       4193
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764642889"
     variation       4195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376647881"
     variation       4197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235617480"
     variation       4206
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369225049"
     variation       4210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760933546"
     variation       4218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363521410"
     variation       4225..4234
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atgatga"
                     /replace="atgatgatga"
                     /db_xref="dbSNP:1558756688"
     variation       4226
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452057912"
     variation       4228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367437976"
     variation       4230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766572412"
     variation       4231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374912295"
     variation       4235
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755016874"
     variation       4238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778728618"
     variation       4239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376925926"
     variation       4246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:754762170"
     variation       4247
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370316650"
     variation       4248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368044415"
     variation       4250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237686107"
     variation       4253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282793986"
     variation       4254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577919832"
     variation       4255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028058886"
     variation       4257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545008599"
     variation       4259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745378850"
     variation       4261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374403850"
     variation       4263
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774746560"
     variation       4265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748725727"
     variation       4266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772413848"
     variation       4273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041395116"
     variation       4277
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756740240"
     variation       4278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150908938"
     variation       4279
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766656471"
     variation       4281
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174750876"
     variation       4283
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356880494"
     variation       4285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759584353"
     variation       4288
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298747880"
     variation       4289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765328971"
     variation       4295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901600438"
     variation       4297
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444331771"
     variation       4300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752679442"
     variation       4301
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139394961"
     variation       4305
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116357144"
     variation       4308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276752529"
     variation       4309
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350870505"
     variation       4311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751403336"
     variation       4312
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205268592"
     variation       4313
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757110639"
     variation       4315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781045802"
     variation       4316
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367971760"
     variation       4318
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253949910"
     variation       4319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755615332"
     variation       4326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572029170"
     variation       4327
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143689284"
     variation       4330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422620950"
     variation       4331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411197349"
     variation       4336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297922860"
     variation       4338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170510108"
     variation       4342
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200216159"
     variation       4343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376989193"
     variation       4350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773706329"
     variation       4351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371532273"
     variation       4363
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747433973"
     variation       4369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273335952"
     variation       4373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364320233"
     variation       4374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252477551"
     variation       4376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771264998"
     variation       4378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776879822"
     variation       4383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316600646"
     variation       4386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430049655"
     variation       4389
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1216036588"
     variation       4391
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178726008"
     variation       4393
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481353761"
     variation       4394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421414425"
     variation       4395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274345577"
     variation       4398
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765328188"
     variation       4406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219786909"
     variation       4407
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73954367"
     variation       4411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189551783"
     variation       4419
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243175854"
     variation       4421..4422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1296459600"
     variation       4421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781636962"
     variation       4423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746160286"
     variation       4424
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223545372"
     variation       4426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531054649"
     variation       4430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775568817"
     variation       4432..4437
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="caa"
                     /replace="caacaa"
                     /db_xref="dbSNP:1340316463"
     variation       4432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763147628"
     variation       4437
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768831588"
     variation       4444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959631427"
     variation       4451
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257526463"
     variation       4454
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774466917"
     variation       4464
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185404663"
     variation       4476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761869351"
     variation       4478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767509179"
     variation       4479
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750240618"
     variation       4480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760385592"
     variation       4483
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766115496"
     variation       4486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248568495"
     variation       4489
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753413117"
     variation       4490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188110040"
     variation       4491
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754523898"
     variation       4493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752155049"
     variation       4495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757774345"
     variation       4502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436135836"
     variation       4504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781484576"
     variation       4505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746309826"
     variation       4506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307478750"
     variation       4510
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770040610"
     variation       4521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780369989"
     variation       4525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256210402"
     variation       4526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1374336917"
     variation       4527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749486775"
     variation       4532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768956209"
     variation       4534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774589902"
     variation       4538
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438277120"
     variation       4539
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138104724"
     variation       4541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236069384"
     variation       4542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772206642"
     variation       4546
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194571762"
     variation       4547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773011911"
     variation       4552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274176758"
     variation       4554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760568596"
     variation       4555
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185324754"
     variation       4556
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759208782"
     variation       4557
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143575824"
     variation       4562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199725467"
     variation       4564
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558758722"
     variation       4565
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:749732214"
     variation       4566
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757898709"
     variation       4567
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200660208"
     variation       4568
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442095768"
     variation       4570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416388254"
     variation       4571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138424495"
     variation       4578
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330130693"
     variation       4582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2581003"
     variation       4587
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756539110"
     variation       4593
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144417032"
     variation       4596
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397950400"
     variation       4597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749616693"
     variation       4598
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1256071663"
     variation       4599
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779277462"
     variation       4600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748300058"
     variation       4603
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772025871"
     variation       4604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773243301"
     variation       4608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1431613238"
     variation       4610
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437002354"
     variation       4612
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746952740"
     variation       4615
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969076325"
     variation       4619
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755384181"
     variation       4623
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360736429"
     variation       4624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779330631"
     variation       4642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748351323"
     variation       4644
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758608703"
     variation       4647
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777738290"
     variation       4650
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311904753"
     variation       4658
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472034310"
     variation       4662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981817639"
     variation       4665
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319778247"
     variation       4666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747054340"
     variation       4667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770777260"
     variation       4671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375938109"
     variation       4672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1369387402"
     variation       4673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369103752"
     variation       4678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769552985"
     variation       4683
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775160504"
     variation       4684
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345401491"
     variation       4689
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558759874"
     variation       4690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160137279"
     variation       4692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762541556"
     variation       4698
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144495063"
     variation       4699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202137644"
     variation       4700
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461448985"
     variation       4702
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143736607"
     variation       4704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759383108"
     variation       4708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767055452"
     variation       4709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754377499"
     variation       4713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760021247"
     variation       4714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962965333"
     variation       4715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376807294"
     variation       4717
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458525248"
     variation       4719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151279248"
     variation       4724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372494251"
     variation       4726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339597888"
     variation       4727
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375902750"
     variation       4728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769563464"
     variation       4730
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758562754"
     variation       4732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201562035"
     variation       4734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751656837"
     variation       4735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757346184"
     variation       4738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238176179"
     variation       4739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149984837"
     variation       4743
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745773198"
     variation       4744
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769675542"
     variation       4746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934787189"
     variation       4748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481881620"
     variation       4749
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761542390"
     variation       4760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199941915"
     variation       4770..4776
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1325234993"
     variation       4775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350687347"
     variation       4777
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435952862"
     variation       4779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291986925"
     variation       4782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364254522"
     variation       4789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375973636"
     variation       4790..4791
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:757019468"
     variation       4792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219295755"
     variation       4793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200853100"
     variation       4795
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454949839"
     variation       4796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2699606"
     variation       4798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756053867"
     variation       4800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009143044"
     variation       4801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2699607"
     variation       4807
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451838089"
     variation       4811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274419167"
     variation       4812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:778474782"
     variation       4814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749099848"
     variation       4815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768479402"
     variation       4816
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2699608"
     variation       4818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772865333"
     variation       4820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446250837"
     variation       4821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760196838"
     variation       4822
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770490160"
     variation       4823
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194880312"
     variation       4825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776050782"
     variation       4828..4829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1404545581"
     variation       4829
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480641945"
     variation       4830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162997344"
     variation       4833
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763275377"
     variation       4834
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764485893"
     variation       4839
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297615490"
     variation       4840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339098486"
     variation       4842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536194673"
     variation       4844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:750108950"
     variation       4844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359305813"
     variation       4848
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356175716"
     variation       4849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226938032"
     variation       4851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148913935"
     variation       4853
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750502612"
     variation       4854
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756176428"
     variation       4857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766280294"
     variation       4860
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487014080"
     variation       4863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189616936"
     variation       4869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392168040"
     variation       4872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753779875"
     variation       4873..4881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaga"
                     /replace="agagaga"
                     /replace="agagagaga"
                     /db_xref="dbSNP:757858017"
     variation       4874
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754834814"
     variation       4877
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778792617"
     variation       4879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747841510"
     variation       4881
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1382433985"
     variation       4885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364837753"
     variation       4889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758128317"
     variation       4890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777563814"
     variation       4892..4893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:779589052"
     variation       4895
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416240957"
     variation       4898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361866767"
     variation       4901
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746575083"
     variation       4902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770543014"
     variation       4905
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1446316699"
     variation       4912
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311831005"
     variation       4914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378669813"
     variation       4916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775899833"
     variation       4919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476863005"
     variation       4920
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749832089"
     variation       4921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768992646"
     variation       4923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201651444"
     variation       4928
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175253968"
     variation       4938..4942
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgctg"
                     /db_xref="dbSNP:747445128"
     variation       4940
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225371530"
     variation       4943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348912440"
     variation       4944
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201857128"
     variation       4949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240259834"
     variation       4955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572432590"
     variation       4956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780774991"
     variation       4961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745310946"
     variation       4963
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769206694"
     variation       4967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253258219"
     variation       4971
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283995110"
     variation       4973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449274621"
     variation       4974
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200257241"
     variation       4975
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448580295"
     variation       4976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148220751"
     variation       4986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1429175725"
     variation       4989
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477078252"
     variation       4994
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772397145"
     variation       4997
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424940430"
     variation       5000
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773530396"
     variation       5001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329679925"
     variation       5003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393885010"
     variation       5004
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760913258"
     variation       5006
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323794297"
     variation       5009
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330074691"
     variation       5012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221123431"
     variation       5014
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044948041"
     variation       5019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771001974"
     variation       5020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185024170"
     variation       5021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259173887"
     variation       5025..5026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:748622809"
     variation       5041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759532918"
     variation       5042
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210730955"
     variation       5045
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266901132"
     variation       5046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765277966"
     variation       5047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752658558"
     variation       5052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1482403797"
     variation       5053
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264569024"
     variation       5055
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477742567"
     variation       5057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169004358"
     variation       5059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762879219"
     variation       5060
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1458732997"
     variation       5062..5064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1163525932"
     variation       5063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764011155"
     variation       5065
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368402498"
     variation       5066..5068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:770259216"
     variation       5068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751350275"
     variation       5070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370909395"
     variation       5075
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780639205"
     variation       5076
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399387727"
     variation       5077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750013741"
     variation       5080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450641795"
     variation       5083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286626146"
     variation       5084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189410445"
     variation       5086
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545857578"
     variation       5091..5095
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ac"
                     /replace="accac"
                     /db_xref="dbSNP:1351142376"
     variation       5095
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962888913"
     variation       5108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975989583"
     variation       5110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348019973"
     variation       5113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558055277"
     variation       5118..5124
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tatat"
                     /replace="tatatat"
                     /db_xref="dbSNP:1230148458"
     variation       5130..5153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="catcta"
                     /replace="catctacatatatttgtacatcta"
                     /db_xref="dbSNP:775671773"
     variation       5131
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271466805"
     variation       5132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955617899"
     variation       5133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573020322"
     variation       5136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987036827"
     variation       5137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178397875"
     variation       5139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911544223"
     variation       5146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181654071"
     variation       5148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987882981"
     variation       5151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186776070"
     variation       5153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529050333"
     variation       5163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533466887"
     variation       5171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1309475632"
     variation       5178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1217543675"
     variation       5181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:62148108"
     variation       5182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1292804203"
     variation       5195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437144252"
     variation       5198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1396342090"
     variation       5200
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558766717"
     variation       5209
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532969674"
     variation       5210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318268610"
     variation       5211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551059280"
     variation       5212..5216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttgat"
                     /replace="ttgatttgat"
                     /db_xref="dbSNP:1553445816"
     variation       5212..5213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1218060426"
     variation       5214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056424582"
     variation       5218
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:62148109"
     variation       5221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192247419"
     variation       5223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455987030"
     variation       5232
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172454520"
     variation       5240..5241
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1208466301"
     variation       5240
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403634202"
     variation       5244
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528751208"
     variation       5246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016981690"
     variation       5247
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73954369"
     variation       5249
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236652584"
     variation       5252
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336300674"
     variation       5253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295398911"
     variation       5258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1434067400"
     variation       5259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407165430"
     variation       5261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450503579"
     variation       5262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191216410"
     variation       5263
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1464261914"
     variation       5265
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268444715"
     variation       5273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361372018"
     variation       5276
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358026210"
     variation       5277
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176133268"
     variation       5278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028429691"
     variation       5280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388854394"
     variation       5291
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955566135"
     variation       5295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13386343"
     variation       5301
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1264335575"
     variation       5303
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986982843"
     variation       5304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031900776"
     variation       5310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256851996"
     variation       5314
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55720651"
     variation       5319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569225412"
     variation       5320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914948277"
     variation       5321..5323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1227576409"
     variation       5325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326769329"
     variation       5330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539835398"
     variation       5331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968201318"
     variation       5333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377952805"
     variation       5338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313187438"
     variation       5340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416079569"
     variation       5342
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368181213"
     variation       5344
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866792649"
     variation       5350
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462963388"
     variation       5351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240945343"
     variation       5362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112191045"
     variation       5363
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1475495914"
     variation       5373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423661350"
     variation       5374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1195740677"
     variation       5376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427180313"
     variation       5377
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257105610"
     variation       5383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980572702"
     variation       5396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482074306"
     variation       5399
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251218791"
     variation       5404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204296656"
     variation       5409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339971022"
     variation       5410
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253051915"
     variation       5420..5425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gtg"
                     /replace="gtggtg"
                     /db_xref="dbSNP:1452534649"
     variation       5423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479970299"
     variation       5426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1320955821"
     variation       5428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293465827"
     variation       5450
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176838193"
     variation       5451
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:832337"
     variation       5458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1416327253"
     variation       5460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316500201"
     variation       5461
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113789039"
     variation       5462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431647587"
     variation       5473
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378152"
     variation       5474
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457667192"
     variation       5475
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:832336"
     variation       5487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167315959"
     variation       5488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1471748514"
     variation       5490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411574216"
     variation       5495..5496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:4012117"
     variation       5496
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2378154"
     variation       5497..5498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gta"
                     /db_xref="dbSNP:1558766996"
     variation       5497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1182953928"
     variation       5498..5500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1284270790"
     variation       5498..5499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gta"
                     /replace="ta"
                     /db_xref="dbSNP:1553445879"
     variation       5498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2378155"
     variation       5499..5500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gtat"
                     /db_xref="dbSNP:1221714822"
     variation       5499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208006163"
     variation       5502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316010105"
     variation       5503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273617298"
     variation       5506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573533045"
     variation       5509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283195699"
     variation       5514
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543978777"
     variation       5515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:539351545"
     variation       5516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266191413"
     variation       5518
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762087458"
     variation       5522
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337028099"
     variation       5523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490152416"
     variation       5526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299733165"
     variation       5527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189815100"
     variation       5528
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054238405"
     variation       5530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544995658"
     variation       5536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:908463105"
     variation       5541
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159424201"
     variation       5542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468468375"
     variation       5545..5551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aataata"
                     /replace="aataataata"
                     /db_xref="dbSNP:1157031428"
     variation       5549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196614906"
     variation       5550
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1453700573"
     variation       5552
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378156"
     variation       5555
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378157"
     variation       5557..5560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:3085016"
     variation       5570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140657360"
     variation       5571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182139925"
     variation       5575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304353417"
     variation       5580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558767100"
     variation       5581..5588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tatt"
                     /replace="tatttatt"
                     /db_xref="dbSNP:776214794"
     variation       5581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253760134"
     variation       5582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1231955452"
     variation       5595
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898518621"
     variation       5600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2378159"
     variation       5602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190773265"
     variation       5604
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350897173"
     variation       5607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319151741"
     variation       5614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997325875"
     variation       5618..5623
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttg"
                     /replace="ttgttg"
                     /db_xref="dbSNP:1400098621"
     variation       5620
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172038145"
     variation       5623
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914395394"
     variation       5632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435486700"
     variation       5638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1395598235"
     variation       5641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195436519"
     variation       5652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049812790"
     variation       5656
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891268742"
     variation       5662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144306378"
     variation       5677..5682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atgtta"
                     /db_xref="dbSNP:1223125896"
     variation       5679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008350751"
     variation       5683
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199388347"
     variation       5685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348055361"
     variation       5690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283018275"
     variation       5692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269442399"
     variation       5701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031848686"
     variation       5707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180866908"
     variation       5709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1433378120"
     variation       5716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:13082"
     variation       5724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113711401"
     variation       5726..5729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1377354417"
     variation       5731..5733
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1175388272"
     variation       5739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956479411"
     variation       5742
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383386485"
     variation       5743
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183453099"
     variation       5746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476310149"
     variation       5748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011873219"
     variation       5750..5758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="taaa"
                     /replace="taaaataaa"
                     /db_xref="dbSNP:1164321561"
     variation       5759..5762
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:769917184"
     variation       5760..5766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tctt"
                     /replace="tcttctt"
                     /db_xref="dbSNP:772571548"
     variation       5760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485675018"
     variation       5761
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558767236"
     variation       5762
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259044198"
     variation       5764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569342824"
     variation       5772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408746703"
     variation       5775..5781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ta"
                     /replace="taaagta"
                     /db_xref="dbSNP:1022362439"
     variation       5776
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539501211"
     variation       5779
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336742459"
     variation       5783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448451420"
     variation       5787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1802988"
     variation       5792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:967770522"
     variation       5796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234161846"
     variation       5800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980488458"
     variation       5803
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926378917"
     variation       5804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409335381"
     variation       5810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353856249"
     variation       5812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960490963"
     variation       5814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411395436"
     variation       5827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283811252"
     variation       5828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551848221"
     variation       5830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163711067"
     variation       5831
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1246134093"
     variation       5835..5841
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="act"
                     /replace="actgact"
                     /db_xref="dbSNP:1419641321"
     variation       5841..5843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1267107620"
     variation       5842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188505728"
     variation       5844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992001387"
     variation       5846
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322871004"
     variation       5855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450190692"
     variation       5857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908413984"
     variation       5858..5859
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1558767324"
     variation       5858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1558767316"
     variation       5859..5862
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="cact"
                     /db_xref="dbSNP:1558767332"
     variation       5859..5860
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1558767335"
     variation       5859
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:11450019"
     variation       5860..5863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:200595333"
     variation       5860
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:60305801"
     variation       5860
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1558767340"
     variation       5861..5864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="cttg"
                     /db_xref="dbSNP:1558767351"
     variation       5862..5871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttgag"
                     /replace="ttgagttgag"
                     /db_xref="dbSNP:752569803"
     variation       5862..5864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:60926806"
     variation       5864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201147238"
     variation       5866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:59534639"
     variation       5867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1458928236"
     variation       5874
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223282533"
     variation       5882
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533916022"
     variation       5888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280004044"
     variation       5891
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444333118"
     variation       5892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347852897"
     variation       5893..5906
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agg"
                     /replace="aggctcttgatagg"
                     /db_xref="dbSNP:1241587413"
     variation       5896
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461805715"
     variation       5898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444056106"
     variation       5903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188286149"
     variation       5907
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1370297350"
     variation       5908
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474682068"
     variation       5914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396204325"
     variation       5915..5919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcatg"
                     /replace="gcatggcatg"
                     /db_xref="dbSNP:201005838"
     variation       5919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1401480430"
     variation       5921
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:59363501"
     variation       5922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1038318683"
     variation       5933
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477311394"
     variation       5934
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1404946841"
     variation       5938
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194653203"
     variation       5939
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1558767419"
     variation       5942
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470157934"
     variation       5945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396276742"
     variation       5950
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215343208"
     variation       5955
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317552283"
     variation       5959
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555867147"
     variation       5960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286459366"
     variation       5970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217595057"
     variation       5975
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2918774"
     variation       5976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:919892431"
     variation       5979
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932685274"
     variation       5983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324183330"
     variation       6000
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372915077"
     variation       6003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537662541"
     variation       6012
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452629907"
     variation       6013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556041345"
     variation       6014
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534975075"
     variation       6018
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891216477"
     variation       6024
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394997213"
     variation       6030
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174832847"
     variation       6036
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766545530"
     variation       6037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455808437"
     variation       6038
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577767300"
     variation       6046..6049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gtgt"
                     /replace="gtgtgt"
                     /db_xref="dbSNP:1186100682"
     variation       6052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486304490"
     variation       6056
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244098121"
     variation       6057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368874000"
     variation       6061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347259111"
     variation       6062
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053216235"
     variation       6069
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234967972"
     variation       6071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349724143"
     variation       6083..6088
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="acctta"
                     /db_xref="dbSNP:1461001445"
     variation       6083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293144253"
     variation       6084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381476416"
     variation       6089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290321861"
     variation       6095
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:891988325"
     variation       6096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012232335"
     variation       6099
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1437148852"
     variation       6101
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258276024"
     variation       6103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12779"
     variation       6106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4012109"
     variation       6110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180340185"
     variation       6111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968094956"
     variation       6119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440000"
     variation       6120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258343650"
     variation       6131
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478987582"
     variation       6132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1174673989"
     variation       6136
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001872678"
     variation       6137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486591548"
     variation       6138..6141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gt"
                     /replace="gtgt"
                     /db_xref="dbSNP:1558767570"
     variation       6139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249609067"
     variation       6144
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033396935"
     variation       6149
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1156551322"
     variation       6151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429053594"
     variation       6153
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466179254"
     variation       6154
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1307875407"
     variation       6155
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297197760"
     variation       6159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:832333"
     variation       6160
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145909274"
     variation       6164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015829547"
     variation       6169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416132693"
     variation       6178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573869381"
     variation       6182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298700346"
     variation       6183
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1342252431"
     variation       6190..6194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:974373079"
     variation       6192..6198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /replace="tgttgttgtt"
                     /db_xref="dbSNP:1221635519"
     variation       6194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61514892"
     variation       6199
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312564750"
     variation       6201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418895361"
     variation       6203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190144180"
     variation       6204
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471683135"
     variation       6208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932617954"
     variation       6210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1258049070"
     variation       6213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195165001"
     variation       6216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480815777"
     variation       6222
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1252881600"
     variation       6223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2378160"
     variation       6229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187895616"
     variation       6234
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1160367982"
     variation       6236
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378161"
     variation       6245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053162216"
     variation       6246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378162"
     variation       6247
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763600564"
     variation       6248
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399318714"
     variation       6250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489526919"
     variation       6251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197906673"
     variation       6252
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395473598"
     variation       6253..6258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1167385436"
     variation       6258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268541692"
     variation       6268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434184395"
     variation       6278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043662482"
     variation       6279
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361747406"
     variation       6285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765562753"
     variation       6286
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906124289"
     variation       6289..6300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttaattt"
                     /replace="ttaatttaattt"
                     /db_xref="dbSNP:3085045"
     variation       6289..6294
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttaatt"
                     /db_xref="dbSNP:1252631114"
     variation       6293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467914439"
     variation       6308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1273365164"
     variation       6310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361913552"
     variation       6315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378163"
     variation       6322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378164"
     variation       6330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368029879"
     variation       6331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1338043991"
     variation       6333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896181236"
     variation       6336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440552153"
     variation       6338
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533561946"
     variation       6339
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372185386"
     variation       6343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013312701"
     variation       6353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1015361362"
     variation       6354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384586693"
     variation       6357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558767766"
     variation       6361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2889839"
     variation       6368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455476669"
     variation       6369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551615281"
     variation       6373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191563215"
     variation       6378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:527697632"
     variation       6383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253415458"
     variation       6385
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183670485"
     variation       6387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985368663"
     variation       6388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912551539"
     variation       6392..6394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:944056853"
     variation       6393
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278730030"
     variation       6405..6410
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1234244930"
     variation       6412
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567228584"
     variation       6416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412906767"
     variation       6417
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429112375"
     variation       6421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326074701"
     variation       6423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913318430"
     variation       6431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542817137"
     variation       6432
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373717460"
     variation       6433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310940403"
     variation       6435
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433999304"
     variation       6441
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:561406552"
     variation       6443..6449
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:1395653065"
     variation       6443
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537801720"
     variation       6445
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:10195411"
     variation       6446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937562875"
     variation       6463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193459256"
     variation       6464
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057402731"
     variation       6472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:571389758"
     variation       6477..6480
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1162831721"
     variation       6477
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1209591626"
     variation       6483
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013260347"
     variation       6484
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459406823"
     variation       6486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213169472"
     variation       6495
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527379338"
     variation       6498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189555874"
     variation       6501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270927151"
     variation       6505
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558767898"
     variation       6509
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229913505"
     variation       6512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192380834"
     variation       6514
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572137113"
     variation       6515..6526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttt"
                     /replace="tttttttacttt"
                     /db_xref="dbSNP:1336105260"
     variation       6515..6521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1375979398"
     variation       6520
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407934661"
     variation       6523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1446232675"
     variation       6523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395543066"
     variation       6533..6536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:767944105"
     variation       6534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478586175"
     variation       6559
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185512962"
     variation       6560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186601190"
     variation       6561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554558878"
     variation       6562
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239669794"
     variation       6570..6571
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1203045993"
     variation       6573
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437571917"
     variation       6574..6577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1274121705"
     variation       6574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006735460"
     variation       6576
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1019510323"
     variation       6590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312139012"
     variation       6593..6595
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1292964418"
     variation       6594..6600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttctctt"
                     /replace="ttctcttctctt"
                     /db_xref="dbSNP:869036614"
     variation       6595
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322798110"
     variation       6599..6601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1553446197"
     variation       6601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115011524"
     variation       6602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357451513"
     variation       6606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285839246"
     variation       6607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753983574"
     variation       6608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913258888"
     variation       6609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457654427"
     variation       6612
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754964550"
     variation       6614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391818434"
     variation       6617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163783521"
     variation       6621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758232455"
     variation       6622
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968830163"
     variation       6625
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3889416"
     variation       6629
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1239675850"
     variation       6634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927415503"
     variation       6635..6638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1470043687"
     variation       6640
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234034336"
     variation       6644
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180880221"
     variation       6645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378165"
     variation       6648..6652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1442210106"
     variation       6652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2378166"
     variation       6653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2378167"
     variation       6656
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758153126"
     variation       6658
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182395608"
     variation       6659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413911795"
     variation       6666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558768065"
     variation       6668..6672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:1349866474"
     variation       6671..6674
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:538760382"
     variation       6673..6678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aat"
                     /replace="aataat"
                     /db_xref="dbSNP:1168234801"
     variation       6673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371013043"
     variation       6677..6679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="att"
                     /db_xref="dbSNP:1353459075"
     variation       6677
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2099607"
     variation       6678..6683
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1368525082"
     variation       6678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917510907"
     variation       6679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353703643"
     variation       6686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351294344"
     variation       6690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563179808"
     variation       6691..6696
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1409277678"
     variation       6697..6703
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttacttt"
                     /db_xref="dbSNP:1036696314"
     variation       6697..6702
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttactt"
                     /db_xref="dbSNP:1160977932"
     variation       6701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252785201"
     variation       6708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753251180"
     variation       6709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332270148"
     variation       6711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190421803"
     variation       6713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215141556"
     variation       6716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447670874"
     variation       6717
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149196384"
     variation       6720..6724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1242269628"
     variation       6729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345413957"
     variation       6732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143276373"
     variation       6739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219655739"
     variation       6741..6745
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1369263246"
     variation       6743
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558768176"
     variation       6751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527736758"
     variation       6757..6762
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="att"
                     /replace="attatt"
                     /db_xref="dbSNP:1429332630"
     variation       6758..6765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tta"
                     /replace="ttatttta"
                     /db_xref="dbSNP:1230527344"
     variation       6759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549064955"
     variation       6761
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317660942"
     variation       6779..6787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atatgttta"
                     /db_xref="dbSNP:3085067"
     variation       6779..6782
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1395055319"
     variation       6781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174654695"
     variation       6786..6790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="taact"
                     /db_xref="dbSNP:1435339289"
     variation       6786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219680181"
     variation       6790..6792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:757230621"
     variation       6791
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186154754"
     variation       6793
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486214690"
ORIGIN      
ctggaaacattgcccaaagaagacctcatcaagtttgccaagaaacagatgatgctaatacagaaagctaaatcaaggtgtacagaattggagaaagaaattgaagaactcagatcaaaacctgttactgaaggaactggtgatattattaaggcattaactgaacgtctggatgctcttcttctggaaaaagcagagactgagcaacagtgtctttctctgaaaaaggaaaatataaaaatgaagcaagaggttgagctataatgccatctttactaaaagcgaaaaaaagattctgtaacaaagatgggagatgcacataaggagttggaacaatcacatataaactatgtgaaagaaattgaaaatttgaaaaatgagttgatggcagtacgttccaaatacagtgaagacaaagctaacttacaaaagcagctggaagaagcaatgaatacgcaattagaactttcagaacaacttaaatttcagaacaactctgaagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttgaggagcaaattttatatctgcaaaagcaattagacgctaccactgatgaaaagaaggaaacagttactcaactccaaaatatcattgaggctaattctcagcattaccaaaaaaatattaatagtttgcaggaagagcttttacagttgaaagctatacaccaagaagaggtgaaagagttgatgtgccagattgaagcatcagctaaggaacatgaagcagagataaataagttgaacgagctaaaagagaacttagtaaaacaatgtgaggcaagtgaaaagaacatccagaagaaatatgaatgtgagttagaaaatttaaggaaagccacctcaaatgcaaaccaagacaatcagatatgttctattctcttgcaagaaaatacatttgtagaacaagtagtaaatgaaaaagtcaaacacttagaagataccttaaaagaacttgaatctcaacacagtatcttaaaagatgaggtaacttatatgaataatcttaagttaaaacttgaaatggatgctcaacatataaaggatgagttttttcatgaacgggaagacttagagtttaaaattaatgaattattactagctaaagaagaacagggctgtgtaattgaaaaattaaaatctgagctagcaggtttaaataaacagttttgctatactgtagaacagcataacagagaagtacagagtcttaaggaacaacatcaaaaagaaatatcagaactaaatgagacatttttgtcagattcagaaaaagaaaaattaacattaatgtttgaaatacagggtcttaaggaacagtgtgaaaacctacagcaagaaaagcaagaagcaattttaaattatgagagtttacgagagattatggaaattttacaaacagaactgggggaatctgctggaaaaataagtcaagagttcgaatcaatgaagcaacagcaagcatctgatgttcatgaactgcagcagaagctcagaactgcttttactgaaaaagatgcccttctcgaaactgtgaatcgcctccagggagaaaatgaaaagttactatctcaacaagaattggtaccagaacttgaaaataccataaagaaccttcaagaaaagaatggagtatacttacttagtctcagtcaaagagataccatgttaaaagaattagaaggaaagataaattctcttactgaggaaaaagatgattttataaataaactgaaaaattcccatgaagaaatggataatttccataagaaatgtgaaagggaagaaagattgattcttgaacttgggaagaaagtagagcaaacaatccagtacaacagtgaactagaacaaaaggtaaatgaattaacaggaggactagaggagactttaaaagaaaaggatcaaaatgaccaaaaactagaaaaacttatggttcaaatgaaagttctctctgaagacaaagaagtattgtcagctgaagtgaagtctctttatgaggaaaacaataaactcagttcagaaaaaaaacagttgagtagggatttggaggtttttttgtctcaaaaagaagatgttatccttaaagaacatattactcaattagaaaagaaacttcagttaatggttgaagagcaagataatttaaataaactgcttgaaaatgagcaagttcagaagttatttgttaaaactcagttgtatggttttcttaaagaaatgggatcagaagtttcagaagacagtgaagagaaagatgttgttaatgtcctacaggcagtcggtgaatccttggcaaaaataaatgaggaaaaatgcaacctggcttttcagcgtgatgaaaaagtattagagttagaaaaagagattaagtgccttcaagaagagagtgtagttcagtgtgaagaacttaagtctttattgagagactatgagcaagagaaagttctcttaaggaaagagttagaagaaatacagtcagaaaaagaggccctgcagtctgatcttctagaaatgaagaatgctaatgaaaaaacaaggcttgaaaatcagaatcttttaattcaagttgaagaagtatctcaaacatgtagcaaaagtgaaatccataatgaaaaagaaaaatgttttataaaggaacatgaaaacctaaagccactactagaacaaaaagaattacgagataggagagcagagttgatactattaaaggattccttagcaaaatcaccttctgtaaaaaatgatcctctgtcttcagtaaaagagttggaagaaaaaatagaaaatctggaaaaagaatgcaaagaaaaggaggagaaaataaataagataaaattagttgccgtaaaggcaaagaaagaactagattccagcagaaaagagacccagactgtgaaggaagaacttgaatctcttcgatcagaaaaggaccagttatctgcttccatgagagatctcattcaaggagcagaaagctataagaatcttttattagaatatgaaaagcagtcagagcaactggatgtggaaaaagaacgtgctaataattttgagcatcgtattgaagaccttacaagacaattaagaaattcgactttgcagtgtgaaacaataaattctgataatgaagatctcctggctcgtattgagacattacagtctaatgccaaattattagaagtacagattttagaagtccagagagccaaagcaatggtagacaaagaattagaagctgaaaaacttcagaaagaacagaagataaaggaacatgccactactgtaaatgaacttgaagaacttcaggtacaacttcaaaagcaaaagaaacagcttcagaaaaccatgcaagaattagagctggttaaaaaggatgcccaacaaaccacattgatgaatatggaaatagctgattatgaacgtttgatgaaagaactaaatcaaaagttaactaataaaaacaacaagatagaagatttggagcaagaaataaaaattcaaaaacagaaacaagaaaccctacaagaagaaataacttcattacagtcttcagtacaacaatatgaagaaaaaaacaccaaaatcaagcaattgcttgtgaaaaccaaaaaggaactggcagattcaaagcaagcagaaactgatcacttaatacttcaagcatctttaaaaggtgagctggaggcaagccagcagcaagtagaagtctataaaatacagctggctgaaataacatcagagaagcacaaaatccacgagcacctgaaaacctctgcggaacagcaccagcgtacgctaagtgcataccagcagagagtgacagcactacaggaagagtgccgtgctgccaaggcagaacaagctactgtaacctctgaattcgagagctacaaagtccgagttcataatgttctaaaacaacagaaaaataaatctatgtctcaggctgaaactgagggcgctaaacaagaaagggaacatctggaaatgctgattgaccagctaaaaatcaaattacaagatagccaaaataacttacagattaatgtatctgaacttcaaacattgcagtctgaacatgatacactgctagaaaggcacaacaagatgctgcaggaaactgtgtccaaagaggcggaactccgggaaaaattgtgttcaatacagtcagagaacatgatgatgaaatctgaacatacacagactgtgagtcagctaacatcccagaacgaggtccttcgaaatagcttccgagatcaagtgcgacatttgcaggaagaacacagaaagacagtggagacattacagcagcagctctccaagatggaagcacagctcttccagcttaagaatgaaccgaccacaagaagcccagtttcctctcaacaatctttgaagaaccttcgagaaaggagaaacacagacctcccgcttctagacatgcacactgtaacccgggaagagggagaaggcatggagacaactgatacggagtctgtgtcttccgccagcacatacacacagtctttagagcagctgcttaactctcccgaaactaaacttgagcctccattatggcatgctgaatttaccaaagaagaattggttcagaagctcagttccaccacaaaaagtgcagatcacttaaacggcctgcttcgggaaacagaagcaaccaatgcaattcttatggagcaaattaagcttctcaaaagtgaaataagaagattggaaaggaatcaagagcgagagaagtctgcagctaacctggaatacttgaagaacgtcttgctgcagttcattttcttgaaaccaggtagtgaaagagagagacttcttcctgttataaatacgatgttgcagctcagccctgaagaaaagggaaaacttgctgcggttgctcaaggtgaggaagaaaatgcttcccgttcttctggatgggcatcctatcttcatagttggtctggacttcgataggttgatggaaggaatatttttattaaccaaatagaatctatttacaaaaatggttcacgtatattaccacaattcttttgtcaaaaagtgtgtatatatgtttgcatctacatatatttgtacatctatatgacagatgtattttaaaagtttcatcttgaagtaaaagtacaacagcttgaagtgttgatagcaggccacagccctctaactcatgtgatttcccatgcatgctgccagaataaaaccaccaggaatgaattcactccccacttctctggaacctcaggacccgcccatttctcggcagtactgtgaattttgaagttaaactaaattttggtaccataccaactggaatttaggctttaaaaataatgtttcaaggccaggtgtggtgattcatgcctgaaatcccactactttgggaggctgaggctggagaattgcttgaggctagtgagctgtgactcccactgcactccagctcggggaacagagcgagaccttgtctctaaaaataatagtaataaaataaaaataacgttttatgactatttattgcaaggtcagagttacagattgttataaattgttgagaaatttttgtgattagaatatgaaggaaaaagctttgttggtaaaagtgacatgttaaggggctatgaagtaaatatgctgcagttaattatgctaagttaaaatacagtttagttatttgctttaaaataaactcttctttttttctttaaagtatactatctcaaaactcattatgttgtcagagccctagagctggctagtgtaacactgactatgagtaggtgggcccacacttgagttgaggtgatttcatggtgtctttccaggctcttgatagggtgtcactgcatgcaagccatgaatctgttttgagaatcctctccattttcccaaataaaaacctatcacaacagtgactatatcactcagcattggatctaaatataaaagtggtgctttcagtgtttttggcagatagtgttccataagctttccatcagaagggattttagacaccttagaggtccgtgctacatcgtcacagttcctccgaataaccttaggtggtagtgttacttgcctttgacacctctgcatatgttttaatgactagatccaaactgtgttgttcttaaatcaaaaattggataatttgtaatatttatgtgttaatcacacagtatgctctctgaagttctcttaagccttcagtttatactcttaatttaattttctttctgagctggagaactggctttgcactttggttacacagaacattggtttccaattcagtttaactgaaatttgctgctgatatgttgagtttgttctttaaaaaatagctcatatatctcatctttcctcctgtcttagaagaacagacctaactagtgaatgtattaatgaaaatgcatctatttcagagctgacatgaagagtttagtttttttactttataaactgtgaatatgagtatgccagctgcatacgatgtaactaatcatatttaaatatatttcactttctctttgactttagaccttttgaagtctgtataaacttgttttgaaatatagtctctgcttacgaatgtcataacaaaataattttttgcatgataaaaaattactttgattacaaaaggcatattctttcatggtttctgcaatgagaggaagtgtaatgattattttaatatttctattaaatatgtttaactgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]