GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 06:18:45, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_011390444            1041 bp    mRNA    linear   PLN 03-APR-2018
DEFINITION  Ustilago maydis 521 hypothetical protein (UMAG_02463), partial
            mRNA.
ACCESSION   XM_011390444
VERSION     XM_011390444.1
DBLINK      BioProject: PRJNA14007
            BioSample: SAMN02900459
KEYWORDS    RefSeq.
SOURCE      Ustilago maydis 521
  ORGANISM  Ustilago maydis 521
            Eukaryota; Fungi; Dikarya; Basidiomycota; Ustilaginomycotina;
            Ustilaginomycetes; Ustilaginales; Ustilaginaceae; Ustilago.
REFERENCE   1  (bases 1 to 1041)
  AUTHORS   Kamper,J., Kahmann,R., Bolker,M., Ma,L.J., Brefort,T.,
            Saville,B.J., Banuett,F., Kronstad,J.W., Gold,S.E., Muller,O.,
            Perlin,M.H., Wosten,H.A., de Vries,R., Ruiz-Herrera,J.,
            Reynaga-Pena,C.G., Snetselaar,K., McCann,M., Perez-Martin,J.,
            Feldbrugge,M., Basse,C.W., Steinberg,G., Ibeas,J.I., Holloman,W.,
            Guzman,P., Farman,M., Stajich,J.E., Sentandreu,R.,
            Gonzalez-Prieto,J.M., Kennell,J.C., Molina,L., Schirawski,J.,
            Mendoza-Mendoza,A., Greilinger,D., Munch,K., Rossel,N., Scherer,M.,
            Vranes,M., Ladendorf,O., Vincon,V., Fuchs,U., Sandrock,B., Meng,S.,
            Ho,E.C., Cahill,M.J., Boyce,K.J., Klose,J., Klosterman,S.J.,
            Deelstra,H.J., Ortiz-Castellanos,L., Li,W., Sanchez-Alonso,P.,
            Schreier,P.H., Hauser-Hahn,I., Vaupel,M., Koopmann,E.,
            Friedrich,G., Voss,H., Schluter,T., Margolis,J., Platt,D.,
            Swimmer,C., Gnirke,A., Chen,F., Vysotskaia,V., Mannhaupt,G.,
            Guldener,U., Munsterkotter,M., Haase,D., Oesterheld,M., Mewes,H.W.,
            Mauceli,E.W., DeCaprio,D., Wade,C.M., Butler,J., Young,S.,
            Jaffe,D.B., Calvo,S., Nusbaum,C., Galagan,J. and Birren,B.W.
  TITLE     Insights from the genome of the biotrophic fungal plant pathogen
            Ustilago maydis
  JOURNAL   Nature 444 (7115), 97-101 (2006)
   PUBMED   17080091
REFERENCE   2  (bases 1 to 1041)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (03-APR-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1041)
  AUTHORS   Guldener,U., Munsterkotter,M., Walter,M.C., Mannhaupt,G. and
            Kahmann,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (02-SEP-2014) Institute of Bioinformatics and Systems
            Biology, Helmholtz Zentrum Muenchen, German Research Center for
            Environmental Health (GmbH), Ingolstaedter Landstrasse 1,
            Neuherberg, Bavaria 85764, Germany
REFERENCE   4  (bases 1 to 1041)
  AUTHORS   Birren,B., Nusbaum,C., Abebe,A., Abouelleil,A., Adekoya,E.,
            Ait-zahra,M., Allen,N., Allen,T., An,P., Anderson,M., Anderson,S.,
            Arachchi,H., Armbruster,J., Bachantsang,P., Baldwin,J., Barry,A.,
            Bayul,T., Blitshsteyn,B., Bloom,T., Blye,J., Boguslavskiy,L.,
            Borowsky,M., Boukhgalter,B., Brunache,A., Butler,J., Calixte,N.,
            Calvo,S., Camarata,J., Campo,K., Chang,J., Cheshatsang,Y.,
            Citroen,M., Collymore,A., Considine,T., Cook,A., Cooke,P.,
            Corum,B., Cuomo,C., David,R., Dawoe,T., Degray,S., Dodge,S.,
            Dooley,K., Dorje,P., Dorjee,K., Dorris,L., Duffey,N., Dupes,A.,
            Elkins,T., Engels,R., Erickson,J., Farina,A., Faro,S., Ferreira,P.,
            Fischer,H., Fitzgerald,M., Foley,K., Gage,D., Galagan,J.,
            Gearin,G., Gnerre,S., Gnirke,A., Goyette,A., Graham,J.,
            Grandbois,E., Gyaltsen,K., Hafez,N., Hagopian,D., Hagos,B.,
            Hall,J., Hatcher,B., Heller,A., Higgins,H., Honan,T., Horn,A.,
            Houde,N., Hughes,L., Hulme,W., Husby,E., Iliev,I., Jaffe,D.,
            Jones,C., Kamal,M., Kamat,A., Kamvysselis,M., Karlsson,E.,
            Kells,C., Kieu,A., Kisner,P., Kodira,C., Kulbokas,E., Labutti,K.,
            Lama,D., Landers,T., Leger,J., Levine,S., Lewis,D., Lewis,T.,
            Lindblad-toh,K., Liu,X., Lokyitsang,T., Lokyitsang,Y., Lucien,O.,
            Lui,A., Ma,L.J., Mabbitt,R., Macdonald,J., Maclean,C., Major,J.,
            Manning,J., Marabella,R., Maru,K., Matthews,C., Mauceli,E.,
            Mccarthy,M., Mcdonough,S., Mcghee,T., Meldrim,J., Meneus,L.,
            Mesirov,J., Mihalev,A., Mihova,T., Mikkelsen,T., Mlenga,V.,
            Moru,K., Mozes,J., Mulrain,L., Munson,G., Naylor,J., Newes,C.,
            Nguyen,C., Nguyen,N., Nguyen,T., Nicol,R., Nielsen,C., Nizzari,M.,
            Norbu,C., Norbu,N., O'donnell,P., Okoawo,O., O'leary,S.,
            Omotosho,B., O'neill,K., Osman,S., Parker,S., Perrin,D.,
            Phunkhang,P., Piqani,B., Purcell,S., Rachupka,T., Ramasamy,U.,
            Rameau,R., Ray,V., Raymond,C., Retta,R., Richardson,S., Rise,C.,
            Rodriguez,J., Rogers,J., Rogov,P., Rutman,M., Schupbach,R.,
            Seaman,C., Settipalli,S., Sharpe,T., Sheridan,J., Sherpa,N.,
            Shi,J., Smirnov,S., Smith,C., Sougnez,C., Spencer,B., Stalker,J.,
            Stange-thomann,N., Stavropoulos,S., Stetson,K., Stone,C., Stone,S.,
            Stubbs,M., Talamas,J., Tchuinga,P., Tenzing,P., Tesfaye,S.,
            Theodore,J., Thoulutsang,Y., Topham,K., Towey,S., Tsamla,T.,
            Tsomo,N., Vallee,D., Vassiliev,H., Venkataraman,V., Vinson,J.,
            Vo,A., Wade,C., Wang,S., Wangchuk,T., Wangdi,T., Whittaker,C.,
            Wilkinson,J., Wu,Y., Wyman,D., Yadav,S., Yang,S., Yang,X.,
            Yeager,S., Yee,E., Young,G., Zainoun,J., Zembeck,L., Zimmer,A.,
            Zody,M. and Lander,E.
  TITLE     Direct Submission
  JOURNAL   Submitted (23-JUL-2003) Whitehead Institute/MIT Center for Genome
            Research, 320 Charles Street, Cambridge, MA 02142, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_026482).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1041
                     /organism="Ustilago maydis 521"
                     /mol_type="mRNA"
                     /strain="521"
                     /culture_collection="FGSC:9021"
                     /db_xref="taxon:237631"
                     /chromosome="5"
     gene            <1..>1041
                     /locus_tag="UMAG_02463"
                     /db_xref="GeneID:23563204"
     CDS             1..1041
                     /locus_tag="UMAG_02463"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_011388746.1"
                     /db_xref="GeneID:23563204"
                     /translation="
MEGINADTKLESLTDAQRLELASKLQSESTSHQALISAVEPIEVLEKEYAANRAFLGKIKWLKEEAGFIGLRRAKGDGDCFYRAFAFAFIYKIMMMKDRPMHHFTVKHVESTLQLLKHAGFDEEVVTDFYEPLKNLLNRMYSTDPESQELNEHALLQAMNEPEQSNSIVVYLRLLTSAFLKLNADEYTPFLFSLDTSSDAGPPDMASFCANQVEAIGKEADHVQITALSRALKVSLDVAYLSPQQAPPQTPLDEEFPAEQLHQSTENSSDPTCRASASIPVPGNDAQRTRSAAEHPDRCDVVRFEVEGGQITEIGTMLLRPGHYDLLVEAPVPASPEPEIPAILSA"
     misc_feature    82..981
                     /locus_tag="UMAG_02463"
                     /note="Peptidase C65 Otubain; Region: Peptidase_C65;
                     pfam10275"
                     /db_xref="CDD:287276"
ORIGIN      
atggaaggcatcaacgcagacacaaagctcgaatcgcttaccgatgcacagcggctcgagctggcatcgaaattgcagagcgagtccacatcgcaccaagcgctcatctcggcagtcgagccgatcgaggtgttggaaaaagagtatgcggcgaatcgtgcgtttttgggcaagatcaagtggttgaaggaggaagcgggattcatcgggctgcgacgcgccaagggtgatggtgattgtttctaccgagctttcgcgttcgcgttcatctacaagatcatgatgatgaaggatcgaccgatgcaccatttcacggtaaagcatgtagagtcgacgctgcaactcttgaagcacgccgggtttgatgaagaggtggtgacggatttctacgagccactcaagaatctgctcaaccgcatgtactcgaccgatccggaatcgcaggagctcaacgaacacgcgcttctgcaagcgatgaacgagcccgagcagagcaattcgattgtcgtgtatctgcgactgctgacgtcggcgttcctcaaactcaacgcggacgaatatacgcctttcctgttctcgctcgacacgagctcggacgctggaccaccggacatggccagcttctgcgccaaccaggtggaagccatcggtaaggaagccgatcacgtacagatcaccgcgctctcgcgcgcactcaaggtgtcgctcgacgtcgcctacctatcgccccagcaagctccgccccaaaccccgctcgacgaagagttccccgccgaacaactgcaccagtccaccgagaactcatccgaccccacttgtcgcgcatccgcatcaataccggtacccggcaacgacgcgcagcgcaccagatccgccgctgaacatccggatcgatgcgacgtcgtccgcttcgaggtcgaggggggccagatcaccgagatcggaaccatgctcctccgtccaggtcactatgacctcctcgtagaggcgcccgtcccagcttcgcccgaaccggaaatccctgcgattctctcggcgtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]