GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-20 11:56:39, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XM_011244093            4049 bp    mRNA    linear   ROD 22-JUN-2016
DEFINITION  PREDICTED: Mus musculus nrde-2 necessary for RNA interference,
            domain containing (Nrde2), transcript variant X2, mRNA.
ACCESSION   XM_011244093
VERSION     XM_011244093.2
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000078.6) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 22, 2016 this sequence version replaced XM_011244093.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Mus musculus Annotation Release 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4049
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="12"
     gene            1..4049
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /note="nrde-2 necessary for RNA interference, domain
                     containing; Derived by automated computational analysis
                     using gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 mRNAs, 113 ESTs, 17 long SRA
                     reads, 2 Proteins, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 15 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:217827"
                     /db_xref="MGI:MGI:2670969"
     CDS             1094..3895
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X1"
                     /protein_id="XP_011242395.1"
                     /db_xref="GeneID:217827"
                     /db_xref="MGI:MGI:2670969"
                     /translation="
MRTEGIAVCSNPEPASSEPVTFIPVKDSAEAATPVTSWLNPLGIYDQSTTQWLQGQGPAEQESKQPDSQQDRENAALKARVEEFNRRVRENPWDTQLWMAFVAFQDEVMRSPGIYALGEGEQEKHRKSLKLLLEKKLAVLERAIESNPGSVELKLAKLQLCSEFWEPSALAKEWQKLLFLHPNNTSLWQRYLSFCQSQFGTFSVSKLHSLYGKCLSTLSAVKDGSMLSHPVLPGTEEAMFGLFLQQCHFLRQAGHSEKVISLFQAMVDFTFFKPDSVKELPTKVQVEFFEPFWDSGEPRVGEKGARGWRAWMHQQERGGWVLITPDEDDEEPEEEDQEIKDKTLPRWQIWLAVERSRDQRHWRPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSPDLQFQLIQAFLQFLGVPSGFLPPASCLYLAMDESSIFESELYDEKPLTYFNPSFSGISCVGSMEQLGRPRWTKGHNREGEEFVRNVFHLVLPLLAGKQKSQLSLSWLRYEIAKVIWCLHTKKKRLKSQGKSCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDTALSMAGSSELKDRELCELSLLYAELEMELSPDSRGATTGRAVHILTRLTESSPYGPYTGQVSSTQVLKARKAYELALQDCLGQSCASSPAPAEALDCLGSLVRCFMLFQYLTVGIDAAVQIYGRVFAKLKGSARLEDPGPEDSTSSQSLTNVLEAVSMMHTSLLRFHMNVCVYPLAPLRETLSDALKLYPGNQVLWRAYVQIQNKSHSANKTRRFFDTVTRSAKHLEPWLFAIEAEKLRKKLVESVQRVGGREVHATIPETGLTHRIRALFENAIRSDKGNQCPLLWRMYLNFLVSLGNKERSKGVFYKALQSCPWAKVLYMDAMEYFPDELQEILDVMTEKELRVRLPLEELELLLED"
     misc_feature    1340..2338
                     /gene="Nrde2"
                     /gene_synonym="6720454P05Rik"
                     /note="NRDE-2, necessary for RNA interference; Region:
                     NRDE-2; pfam08424"
                     /db_xref="CDD:285605"
ORIGIN      
tcctcttccggttcctgcttgtccattgttcagtgaagccggagggcactaactacaaggaaactgttcttcctcaatctcaccctcttccctcctcccctctctaccctttgggtctccgcaccgccttgcccaggagttaagccttaaagagtgcaggaagaactacatttcccagagtgcctcgcgagtcaccgtcctccaaccagagctctccagacggcgccatttctgaggcaggagtggtagtgcggcctgtgatcatggcgctgttcccggcttttgcggacgtaagtgaggcctccggtgatggggcattcaggaaaggtgtgtcatctgacaggcaaggatatgatcaagtataagcatcatatgagcggacgctgtcttgtccatcacggtctccccagtacctggaattgtgctagggtacatagcagagttagattggctgagcaacccaagctttcgtgttggaaatctaacttctctgagccgacaaactgaagaggtcacagcccttgcttctgaagggtcaccaccgccaaggtactcttttatcaggagtcctctgaagtcagagctctcaggtgagagcaacactagcgagaagctcgcacagacaagcaggaagaagaagaaggagaaaaagaagagacggaagcatcagcaccacaggaaaaccaagaggaggcacgagcagttgagcagcagcggctctgagtcagacacagaggctgggaaggacagggcttcccggagcatcagggacgaccagaaggaagccgagaaaccctgtcagggaagcaatgcggctgctgctgttgctgctgctgctggacatcggtccatttggctggaagatattcacgatctgaccgacgtcttcaggactgataagaagccagatcctgccaactgggagtataaatctctgtatcgtggggatatagcaaggtacaagaggaagggagactcctgcctgggtatcaatcctaagaaacagtgtatatcttgggaaggggcttctgcagcaaagaagcactcacacaggcacctggagcgctattttaccaagaagaatgtggggttaatgagaacagagggcattgctgtgtgcagtaaccccgagcctgcctcctccgagcccgtcacattcatcccagtgaaggactctgctgaggcagctactcctgttacatcatggctgaatcctctggggatttatgatcagtctaccacacagtggttacaaggacagggtccagcagagcaagagtcaaagcagccggactcgcaacaggacagggagaatgctgctctcaaggccagagtggaagagtttaacagaagggttcgggagaatccttgggacacgcaactatggatggcgtttgtggctttccaggacgaggtcatgaggagtcctggcatctatgcccttggggaaggagaacaggagaagcacaggaagtccctgaagctcctcctggagaagaagctggctgtgctggagcgggccatcgagagcaacccaggcagcgtggagctgaagcttgccaagctgcagctgtgctcagagttctgggagcccagtgcgctggccaaggagtggcagaagctcctcttcctgcaccccaacaacacaagcctgtggcagcgctatctctccttttgccagagccagtttggtaccttttctgtgtccaaactccacagtctgtatggcaagtgcttgagtaccttgtctgctgttaaagatggcagcatgctatcccaccctgtgttgccgggcaccgaggaggccatgtttgggctctttcttcagcagtgccactttctacggcaggctggccactcagagaaggtcatctctttgttccaggccatggttgacttcaccttcttcaagcctgacagtgtgaaagagctgcctactaaagtacaggtggaattctttgagcccttctgggacagcggagaaccacgcgttggggagaagggagcccgaggctggcgggcgtggatgcaccaacaggagcgaggtggctgggtgctcatcaccccagatgaggatgacgaggagcccgaagaggaggaccaggagataaaagacaagaccctgccccggtggcagatctggcttgctgttgagcgttctcgagaccagaggcactggcgtccctggcgccctgataagaccaagaagcaaacggaggaagactgtgaggaccctgagagacaggtgctgtttgatgacattgggcaatctttgatcagactttccagcccagaccttcagttccagctcatccaggcctttctgcagttcctgggcgtgccttccggcttcctgcccccagcctcctgcctttacctggccatggacgagagcagcatctttgagagtgaactttatgatgaaaagcccctgacttacttcaacccttccttttcgggcattagctgtgtcggctccatggaacagttgggtcgccctcgctggaccaaaggtcacaaccgagagggcgaggagtttgtccgcaatgtcttccacctggtgctgcctttgctcgcaggcaagcagaagtcccagctcagcctctcctggttacggtacgagattgcaaaggtcatttggtgtctacacactaaaaagaagcgattgaagtctcagggaaagagctgcaaaaaactagccaagaatctcctcaaggagccagaaaaccgcaacaacttctgcctctggaagcagtatgcacacctggagtggttgctcggtaacacagaggatgccagaaaagtgttcgacacagcactcagcatggcaggcagcagcgagctgaaggaccgtgaactctgcgagctcagtctgctctatgccgagctggagatggaactgtcgccggactcgagaggagccaccacaggccgagcggtccacatattaacacggctgacggagagcagtccctacgggccctacacggggcaggtctcgtccacccaggtgctgaaagctcggaaggcttacgagctcgcgctgcaggactgcctgggccagagctgtgcctccagcccagctcctgcagaggccttggactgcctgggtagcttggtccgatgctttatgctcttccagtatttgactgtgggcattgatgctgctgtgcagatatacggaagggtgtttgccaagctgaagggctctgctcgcttagaagacccagggccagaggacagcaccagctcccagagtttgaccaatgtgctcgaggctgtcagcatgatgcacacaagcctgctgcgattccacatgaacgtttgtgtttaccctctggctccactccgagagaccctctccgatgctttaaagctgtatccgggcaaccaggttctttggagggcttatgtacagattcagaataagtcccacagtgctaacaagaccagaaggttctttgacacagttactaggtctgccaaacatttggagccttggctatttgcaatcgaagctgagaagctgaggaaaaagctagtggaatctgttcagagggtaggaggcagagaggtccatgcaacaatccccgagactggccttacgcatcgcatcagagctttgtttgaaaatgcgattcggagcgacaagggcaaccagtgtcccctactgtggaggatgtatttgaattttttggtttccttaggaaacaaagaaagaagcaaaggcgtgttctacaaggccctccagagctgtccttgggcaaaggtgctatacatggacgccatggagtatttcccagacgagctgcaggagatcctggacgtgatgaccgagaaggagctccgtgtgcgcctgccccttgaggagctggagctgctgctggaggattagtgtgcagccaggcctgggccagcctgcagagcccaaagccgcagctgtgcaggctccactgtcctgctggggttggacgtattgacttacatattatatatgtgatctctatgtacaagtggagtcgtgccagtgataaaccttttgtggttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]