LOCUS       XM_010982401            4850 bp    mRNA    linear   MAM 23-OCT-2019
DEFINITION  PREDICTED: Camelus dromedarius ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_010982401
VERSION     XM_010982401.2
DBLINK      BioProject: PRJNA565028
KEYWORDS    RefSeq.
SOURCE      Camelus dromedarius (Arabian camel)
  ORGANISM  Camelus dromedarius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
            Camelidae; Camelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044524.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 23, 2019 this sequence version replaced XM_010982401.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camelus dromedarius Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4850
                     /organism="Camelus dromedarius"
                     /mol_type="mRNA"
                     /isolate="Drom800"
                     /isolation_source="isolated from an animal called Varis"
                     /db_xref="taxon:9838"
                     /chromosome="14"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /country="Austria: Eithental"
                     /collection_date="13-Jan-2013"
                     /collected_by="Pamela Burger"
                     /breed="African"
     gene            1..4850
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 mRNAs, 21 Proteins, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 7 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105090992"
     CDS             461..4843
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_010980703.1"
                     /db_xref="GeneID:105090992"
                     /translation="

MKPEQERRIIDREEANRRILSKLSWTARAWEPEMKQSFAFDNTGYEDGLDGMCPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVVEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMNLGLIDVRRLQSAHPNVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRRSPGPPKGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQWISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENHSSNHVGNHSAESSTGQAGPPVSVQEAAPHPGALPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDYAGSDSDLELIITGMTCTSCVHNIESRLTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVIPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFIDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQNERTAHLNGVSSIPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGRRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLVGIPIAAGVFMPIGVVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPELEWYAAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYISQVSLSSLKSDKLSRHSTAANDRGDKWSLLLNDRDEEQCI"

     misc_feature    641..832
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(659..667,674..676)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    896..1084
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(914..922,929..931)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1247..1414
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1256..1264,1271..1273)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1535..1726
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1553..1561,1568..1570)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1919..2107
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1934..1942,1949..1951)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2144..2335
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2162..2170,2177..2179)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2399..4507
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3392..3394,3398..3400,4436..4438)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3524..3532,3734..3736,3887..3895,3983..3985,
                     4103..4111,4169..4171,4178..4180,4187..4189,4244..4246,
                     4253..4255)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

aagggcgtggcctgtgatggacagctggcgttcccaccctcgggcccctcccccactggaagacccctctcgggcgcccccgccccaagtccagtgtccgccgcccgttggagaccaatgggaggctcttgcgcgtctcggatcgattttcctggtgcggagttcactcccgcagccgctgcggcgtctcggacccgcggcacctcggagccaggcgcggagccggagagggagctgcgcagaggagactcgaagccggcgcccgcagcgccgcaccttccccgcgggcagtgggcgagcctggggatccacatctctgggccgggtctacgcggctcactctctttcatttcctccccggcacgcgccagaggctgaagaccgaggccagagcgcaccagccctagaggtgaccttgggctctgggctgcattacagaagaaattagtgcctcggggagatgaagcccgagcaggagagacggattatagatcgggaagaagccaatcggagaatcctgtctaagctttcctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtgcccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcgtgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggctgtgaagtacgtgccgtcggtcctgagcctacctcaggtttgcagtcacatcgaggacatgggatttgaagccagcgtggtggagggaaaggctgcctcctggccatacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtttcgctcggcagccgggaggcagtcatcacttaccagccttaccttattcaaccccaagagctcagggaccatgtgaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgaacctgggactgatcgatgtcagacggctgcagagcgcccacccaaatgtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatgggatgcactgtaagtcttgtgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcatgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccgctcccctgggccccccaagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagtggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagcgcagaagaactccgagctgccgtggaggacatgggatttgaggcgtccgtcctggctgaaaaccattccagcaaccatgttgggaaccacagtgctgagagttccacggggcaggctggcccccccgtgtctgtgcaggaggcagctccccaccctggggcactccctgaaaaccacaaccctggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgtgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccaggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactacgcgggctcggacagcgacctggagctgatcatcacggggatgacctgcacctcctgtgttcacaacatagagtccagactcacaaggacaaacggcatcacctatgcctctgtggctctcgccaccagcaaagcccatgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgtcatgggtttaatgatctacatgttgatacccagcaacgagccgcatgagtctatggtcctggaccacaacatcatcccaggactgtccatcctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcattgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacaccccccccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacgtcagaagcccttgccaaactcatgtctctgcaagccacggaagccaccgtcgtgactcttggcgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgcggcgataccatcaaggtcatccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagctggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacgtcggtggtatggattgtaatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcattccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaatggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacactgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgtgggatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagaacgaacggaccgctcacctgaatggggtcagcagcatccccgtggaaacagatgcggccccgcagaccttctctgtgctgatcggaaaccgggagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagcgagagccatcgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaacgaggggaggagggtcgccatggtgggcgacggggtcaacgactccccagccctggcccaggccgacgtgggcattgccatcgggacgggcacggatgtcgccatcgaagcggctgacgtcgtcctcatcagaaacgacctgctcgacgtggtggccagcattcatctctccaagaggactgtgtggagaatccggctcaacctggtgctggcgttgatctacaacctggtcgggatacccatcgcagcaggtgtcttcatgcccattggtgtcgtgctgcagccatggatgggctcggcagccatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctataagaagccggagctggagtggtacgcggcgcaggcacagggccgcatgaagcccctgaccgcgtcccaggtcagcgtgcacattggcatggacgaccggcggcgggactccccccgggccacaccctgggaccaggtcagctacatcagccaggtgtccctgtcctccctcaagtccgacaagctgtctcggcacagcactgcggccaatgacagaggggacaagtggtctctgctcctgaatgaccgggatgaggagcagtgcatctgaaagccgc

//