LOCUS       XM_010728776            6055 bp    mRNA    linear   VRT 18-NOV-2019
DEFINITION  PREDICTED: Meleagris gallopavo ATPase copper transporting beta
            (ATP7B), transcript variant X8, mRNA.
ACCESSION   XM_010728776
VERSION     XM_010728776.3
DBLINK      BioProject: PRJNA62397
KEYWORDS    RefSeq.
SOURCE      Meleagris gallopavo (turkey)
  ORGANISM  Meleagris gallopavo
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Meleagridinae; Meleagris.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_015011.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Nov 18, 2019 this sequence version replaced XM_010728776.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Meleagris gallopavo Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6055
                     /organism="Meleagris gallopavo"
                     /mol_type="mRNA"
                     /isolate="NT-WF06-2002-E0010"
                     /db_xref="taxon:9103"
                     /chromosome="1"
                     /sex="female"
                     /tissue_type="blood"
                     /breed="Aviagen turkey brand Nicholas breeding stock"
                     /note="donated by Nicholas Turkey Breeding Farms"
     gene            1..6055
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 31 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:100541545"
     CDS             181..4578
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X8"
                     /protein_id="XP_010727078.1"
                     /db_xref="GeneID:100541545"
                     /translation="

MERKLDNKMRRELSCLATLNNKNITLVSIRKQQAAHDVPELLIIGEGSKAGSLLEASSNLQKEEKVLQRNSMGMPEVNTTGRQVLSNADSPPSCALEPEMKQNFAFDNMGYEETFEAMPSSSSQERTVAVNVVGMTCQSCVQSIEGRISKVKGVVSIKVSLELNNALVKYLQSEISPEQICQEIEDMGFDANVAEERLTPVSVNLPCSREAVMKLRIEGMTCQSCVTSIEGKIKKLHGVAKIKVSLSNQEAVIAYHPYIIQPEELRSHISNLGYDCTIKSKSAPLKLGVLDVRNLQSADPKKTPASLESEGLHPLIANNSSTATVTVHIEGMHCKSCVRNIEGNISSLPGIQSIEVSLEHKCAVVQYSPNLITLPALQQAIESLPPGNFKVCLPNTSEANNQASPSPALVCDLFREPLKDTMCTAVIRIDGMTCNSCVQSIEGTISQRQGVQHVAVSLADKTGTIHYDPANTNGEELRAAIEEMGFDASLLTDIGAGEYKHCPDASSTAAQPRVPEPPHQGCVSDALPDSPHPDEPNQPSGATAKKCFLQVTGMTCASCVSTIERNLQKEEGIVSVLVALMAGKAEIKYKPDLIQPLEIAQLIQNLGFEATVIEDHSEIEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEGIGFHASVSRRVPNTHNLDHRKEIQQWRKSFLCSLVFGIPVLILMIYMLIPGGEHHGAMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYIQAYKSLKHKAANMDVLIVLATTIAYVYSCVILLVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHTIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDIIQKYFPIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTNFQAVPGCGISCKVGGVEAVVGMAEEGVDKLDANKSGDSSAPVGDDTLITLSESNGSSSSHTYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNERRRVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPAGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRSAPWDQISQVSLSSLTSDKLPRQNGFFEEEGDKWSLLMNGGDEEQYI"

     misc_feature    568..753
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(583..591,598..600)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    820..1011
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(838..846,853..855)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1144..1332
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1444..1656
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1825..2013
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1840..1848,1855..1857)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2050..2241
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2068..2076,2083..2085)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2305..4251
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3235..3243,3445..3447,3631..3639,3727..3729,
                     3847..3855,3913..3915,3922..3924,3931..3933,3988..3990,
                     3997..3999)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

tgtacacaaagatcacaggttacatctgggatttcattatgcatgcctaatgagcacattgatgagaactccccaggcccttgtaaaagtagctgaaaaaagagctgctgataaggcactgaatagcttctctcctaaagctttcctttggagttgagatatttaaagccggcaaagataatggagagaaaattggacaataaaatgcgaagggagctgtcctgcctagctactttgaacaacaaaaacataaccctggtgtccattcgaaagcagcaggcagctcacgatgtgcctgaactactgattattggtgaagggtccaaagcagggtctctgctagaagcaagcagcaacttgcagaaagaagagaaagttttgcagcgtaactccatgggaatgccagaagtcaatacaactggaaggcaggttttgtccaatgctgactctcctcctagctgtgcgctggaacctgaaatgaaacagaattttgcttttgacaacatgggctacgaggagacctttgaagccatgccctcatcatcttcccaggaacgcactgttgcagtcaatgttgtgggaatgacttgtcaatcttgtgtgcagtcgatagaaggacgaatttccaaagttaagggtgttgtgagtattaaagtctcccttgaactgaataatgctttagtaaaatatctacagtcagaaataagccctgaacagatttgccaagaaatagaggatatgggctttgacgccaatgtagcagaagaaaggttgacaccagtatctgtaaatttgccatgctcgagagaagcagtaatgaagcttcggatagaaggcatgacgtgccagtcctgcgtcaccagcattgaaggaaagattaagaagcttcacggtgtggcaaaaatcaaggtgtcactcagtaaccaggaagcagttattgcttaccatccttacatcattcagcctgaggaacttaggagccacatcagtaacctggggtacgactgcaccattaagagtaaatcagcacctttgaagcttggtgtgcttgatgtcaggaacctgcagagtgcagaccccaagaagacaccagcatctctcgagagtgagggtttgcatccgctgattgccaacaacagcagcacagctacagtgactgtacatatagaaggcatgcactgcaaatcttgtgtcagaaacattgaaggaaatatatcctctcttccaggcatacaaagtattgaagtctccttggagcataaatgtgctgttgtacagtatagccccaatttaattaccttgcctgctttgcagcaagctattgaatcccttccacctggaaactttaaagtttgcctccctaatacttcagaagcaaataaccaggcatctccatctcctgctttggtatgtgatctcttcagagagccactgaaagacacaatgtgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaaggaacaatatctcagagacaaggtgtgcagcatgtagcagtttctttagctgacaagactgggaccatacattatgatccagcaaacacgaatggtgaggagttgagagctgccatagaagaaatggggtttgatgcatctttgctgacagatattggtgcaggagaatacaagcattgccctgatgccagtagcaccgcagcgcagcctcgagtcccagagcctcctcaccagggttgtgtctccgatgcacttccagacagccctcaccctgatgagccaaaccaacccagcggagcaacagccaagaagtgttttttacaagtcactggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagaaggtattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagcctgacttgatacagcctcttgaaatagcacagttgatccagaatttgggttttgaagccactgtcatagaagatcattcagaaatagaaggaaatgtggagctgcttattacggggatgacttgtgcctcctgtgttcacaatattgaatccaaacttatgagaacaaacggcatattctacgcctcagttgctcttgctacttgcaaagctcacatccagtttgatcctgaaattacaggacctcgagatattataaaaataattgagggaattggctttcatgcttctgtgtctagaagagttccaaatacacataacttggatcacagaaaggaaatacagcagtggaggaagtcttttttgtgcagccttgtgtttggtattcctgtcttaatcctaatgatttatatgctaatacctggcggcgaacaccacggggctatggtgctggagcagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttacatacaagcttacaagtcactgaagcacaaggcagccaatatggatgtgcttatcgtactggccacaacaattgcttacgtgtattcatgtgtgatcctgttggtggcaataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccaatgctgtttgtattcattgcccttgggagatggcttgaacatatagcaaagagtaagacctcagaagctcttgctaaacttatatctctccaagccacggaagccactgtggtgactcttggacctgaccacactatcatcagagaggagcaggtacctgttgaactggttcaaaggggtgatattgtaaaggttgttccaggtggaaagttcccagtggatgggaaggtcattgaaggcaattctatggcagacgagtctctcattactggggaagctatgcctgtcactaaaaagcctgggagcacagtgattgctggctctataaatgcacatggctcagttcttgttaacgcaactcatgttggtaatgataccaccctggcacagatagtgaaattggtggaagaagctcaaatgtcaaaggcaccaatccagcaactggcagataagtttagtggatattttgttccatttatcatcataatttctacagtgactttgatagtatggatcacaattggttttataaattttgatattattcagaaatattttcctatcaagactgtgatgtttgataaaacggggaccattacttgtggagtccctaaagtcatgagggttcttctgctgggagacacagccgtgctctctctgaagaaggtactggcagtggtcggcactgcagaagccagcagtgagcatcctttaggagtggcggtcactaaatactgcaaagaggagcttggaactcagagcctgggatactgcaccaacttccaggcagtcccaggttgtggcatcagctgcaaagtaggtggtgttgaggctgtcgtgggcatggctgaggagggtgttgataagttggacgctaacaagagtggggacagcagtgctcctgtgggagatgacacactgatcacactttctgaatcgaatggttcatcatcttcccacacatactcagtattgattggaaatcgtgagtggatgcgacggaatggcttgcacattgcaaatgatgtcaatgatgccatgacagaccatgaaactaaaggacagacagccatattagtggctatagatggtgccttatgtggaatgattgcaatcgcagacactgtcaagcaggaggcagccctggctgtgcacacactgaaaaacatgggaatagatgtagtgctgataacgggcgacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaagaactccaaaatgagaggagaagggttgcgatggttggtgacggagtcaatgattcccctgcgctagccagggccgacattggaattgcaattggaacgggtaccgatgttgccattgaagcagcagatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcgaagagaacagtgaggagaatacgaataaatctgattcttgccttaatttataatctgcttggaataccaatagcagcaggtgtgttcatgcctgctggtcttgtgcttcagccttggatgggatcagctgccatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttatgaagctcaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagatcggctccttgggatcaaattagtcaagtttctctctcttccttgacttcagacaagctcccgagacaaaatgggttttttgaggaggaaggggacaagtggtcactgctgatgaatggaggagatgaagaacagtacatctgaagtgttgtgttctcagtacagcagggaatgttccacctcaccagtgacaacagggactgagtcatgtcatcaagagtctcaaggttttaagtgaaattattcctctggctcataaaacaattacaattcagttttgtgttgtatggattgtggattttttcaggtcaccagttattcctagtcactgaaagaatctgtgactctattgtgctcatttgcacgtagcaattagtgaaataatgaaacaatagtaattttcagagtctaatagagtttctgtcttttggactgtctgctgggcaccaaatttcatacttcacaccctttctaagtctattctttcaagagcacatgaaacaaaaaatatgttcatagcctccaaaatctatgcccatgtgaaaatatccactgcataaggagctctgtggttggaatgcacagaatcctaactagccatgtcactgtgggagcactttatacttaggattcacgtgcatcttcttggaccaaaaaagcttcagtgtttcactgactatatctctctgaaaagtctctttcaaagactttcactttctttcaactatcgaactcttttgatgcacgttttcacactgaacttgttctgtgattcccactgctttcttagactttttctattgctccataggagctcttttttcttccctttctccaaacaagacatcttctatgacttattactatgtttacagatatccctgtttgggataaattcctttaagtcactaggaattttccattcttaaggaaacccatgaaggcagagcaattagtgatctgagttagtacataattttcctgtggatatcttgcacgatccctgacagtcctggatagttggcagtcggcaatttcttccctctgaccaagtgaagaatttctgtcagtgtgaacgaagctggcagttaccacggagtgactgaaagcagaactatgtctacagttggtgtgactccagcatggctggatgaagtgagttcattacataaatcagcttacaaccagcttaccggttgcttaaagtgcagccatgaggttaaaagggaatggttgaaaagtggccttaaaacgtgggatttcttgttgccatagtttaagtaattcttcctgatgacagaagggtatgaagatctacaatagcttgaattttaaggtaaatggatatctgtgttttcaattggtttcaagttccttttttactctagtttaataagaaattaaggtgctgagaaacccacctttcacttcattgtctttaccaaagctggcagtagctttatcactctcggagggttgaattcaacccttaacaccatttagggtcggtacaataggaaccaactgctgaagtgcactggacctggccctgtggtgctgtactgctgaactgtgggactctgaagtaagcagcccagagttttatattctgatttgagag

//