GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:37:55, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_010352920            6755 bp    mRNA    linear   PRI 25-SEP-2019
DEFINITION  PREDICTED: Rhinopithecus roxellana ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_010352920
VERSION     XM_010352920.2
DBLINK      BioProject: PRJNA565017
KEYWORDS    RefSeq.
SOURCE      Rhinopithecus roxellana (golden snub-nosed monkey)
  ORGANISM  Rhinopithecus roxellana
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Colobinae; Rhinopithecus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044566.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 25, 2019 this sequence version replaced XM_010352920.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rhinopithecus roxellana Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6755
                     /organism="Rhinopithecus roxellana"
                     /mol_type="mRNA"
                     /isolate="Shanxi Qingling"
                     /db_xref="taxon:61622"
                     /chromosome="18"
                     /sex="male"
                     /tissue_type="heart"
                     /dev_stage="adult"
     gene            1..6755
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 mRNAs, 97 ESTs, 19 Proteins, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:104653862"
     CDS             296..4693
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_010351222.1"
                     /db_xref="GeneID:104653862"
                     /translation="
MPEQERQITAREGASRKILSKLSLPTRAWEPAMKKSFAFDNVGYEGGLDGLGPSSQVDTSTIRILGMTCQSCVKSIEDRISSLKGIVSMKVFLEQGSATVKYVPSVVSLQQVCHQIGDMGFEASIAEGKAASWPSRSLPAQEAVVKLRVEGMTCQSCVGSIEGKVGKLQGVVRVKVSLSNQEAVITYQPYLIQPEDLRDHVNDMGFEAAIKNKVAPLSLGPIDIERLQSTNPKRPLSSANQNFNNSETLGHQGRNVVTLQLRIDGMHCKSCVLNIEENIGQLLGVQSIQVSLENKTAQVQYDPSCTSPVALQMAIEALPPGNFKVSLPDAAEGSGIDHRSSSSHSLGSSPRNQVQSTCSTTLIAIAGMTCASCVHTIEGMISQLEGVQQISVSLAEGTGTVLYNPSVISPEELRAAIEDMGFEASVVSENCSTNPLGNHSAGNSMVQTTGGTPTSVQEVAPHAGRLPTNHVPDIWAKSPQSTRAVAPQKCFLQIKGMTCASCVSNIERNLQKEAGVLSVLVALMAGKAEVKYDPEVIQPLEIAQLIQDLGFEAAVMEDSAGSDGNIELTITGMTCASCVHNIESKLTRTNGITYASVALATSKALVKFDPEIIGPRDIIKIIEEIGFHASLAQRNPNAHHLDHKMEIKQWKKSFLCSLVFGIPVMALMIYMLIPSNKPHQSMVLDHNIIPGLSILNLIFFILCTFVQVLGGWYFYVQAYKSLRHRSANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIVKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLIKATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPLIIIMSTLTLVVWIVIGFIDFGVVQKYFPNPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPRVMRVLLLGDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHSERPLSAPASHLNEAGNLPAEKDAAPQTFSVLIGNREWLRRNGLTISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLQSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGINDSPALAQADMGVAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRIVRRIRINLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAHGHMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYVSQVSLSSLTSDKPSRHSTAADDGGDKWSLLLNDRDEEQYI"
     misc_feature    476..667
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(494..502,509..511)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    731..922
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(749..757,764..766)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1073..1249
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1091..1099,1106..1108)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1382..1570
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1397..1405,1412..1414)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1769..1957
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1784..1792,1799..1801)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1991..4360
                     /gene="ATP7B"
                     /note="Cation transport ATPase [Inorganic ion transport
                     and metabolism]; Region: ZntA; COG2217"
                     /db_xref="CDD:225127"
     misc_feature    1994..2185
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2012..2020,2027..2029)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2600..3343
                     /gene="ATP7B"
                     /note="E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122"
                     /db_xref="CDD:278548"
     misc_feature    <3911..4222
                     /gene="ATP7B"
                     /note="Soluble P-type ATPase [General function prediction
                     only]; Region: COG4087"
                     /db_xref="CDD:226572"
ORIGIN      
cccactggaagcccccgcctgggcgcctgcgccccagtccgcggcccagagtccgtcgcctgttggaggccattggctggcctttgcgcaccgcggatcgattttccaggtgcagagttcactgtcgccgcggttgcttcctttgggacccacggcgcccggcagccaggcgcagagtccgaggagggggcagcgcagagctgacccgacgtggcgccacccggcaccttccccgcagacggtgacctttggctctgagccagatcagagaagaattcggtgtccgcgcaggacgatgcctgagcaggagagacagatcactgccagagaaggggccagtcggaaaatcttatctaagctttctttgcctacccgtgcctgggaaccagcaatgaagaagagttttgcttttgacaatgttggctacgaaggtggtctggatggcctgggcccttcttctcaggtggacaccagcacaatcaggatcttgggcatgacttgccagtcatgtgtgaagtccattgaggacagaatttccagtttgaaaggcatcgtgagcatgaaggttttcctggaacaaggcagtgccactgtgaaatatgtaccatcagttgtgagcctgcaacaggtttgccatcaaattggggacatgggcttcgaggccagcattgcagaaggaaaggcagcctcctggccctcaaggtccttgcctgcccaggaggctgtggtcaagctccgggtggagggcatgacctgtcagtcctgtgttggctccattgaaggcaaggtcgggaaactgcaaggagtagtgagagtcaaagtctcactcagcaaccaagaggctgtcatcacttatcagccttatctcattcagcctgaagacctcagggaccatgtaaatgacatgggatttgaagctgccatcaagaacaaagtggctcccttaagcctgggaccaattgatattgagcggttacaaagcactaacccaaagagacctttatcttctgctaaccagaattttaataattctgagaccttgggacaccaaggaaggaatgtggtcaccctccaactgagaatagatggaatgcactgtaaatcttgcgtcttgaatattgaagaaaatattggccaactcctaggggttcaaagtattcaagtgtccttggagaacaaaactgcccaagtacagtatgacccttcttgtaccagcccagtggctctgcagatggctatcgaggcacttccacctgggaactttaaagtttctcttcctgatgcagccgaagggagtgggatagatcacaggtcttccagttctcattcccttggctcctccccaagaaaccaggtgcagagcacatgcagtaccactctgattgccattgctggtatgacctgtgcatcctgtgtccataccattgaaggcatgatctcccaactggaaggggtgcagcaaatatcggtgtctttggccgaagggactggaacagttctttataatccctctgtaattagcccagaagaactcagagctgctatagaagacatgggatttgaggcttcagtcgtttctgaaaactgttctactaaccctcttggaaaccacagtgctgggaattccatggtgcaaactacaggtggtacacctacatctgtgcaggaggtggctccccacgctgggaggctccctacaaaccatgtcccagacatctgggcaaagtccccacaatcaaccagagcagtggcaccgcagaagtgcttcttacagatcaaaggcatgacctgtgcgtcctgtgtgtccaacatagaaaggaatctgcagaaggaagctggtgttctctccgtgttggttgccttgatggcgggaaaggcagaggtcaaatatgacccggaggtcattcagccgctcgagatagctcagttgatccaggacctgggctttgaggcagcagtcatggaggactccgcaggctccgatggcaacattgagctgacaatcacagggatgacctgcgcgtcctgtgtccacaacatagagtccaaactcacgaggacaaatggaatcacgtatgcctccgttgcccttgccaccagcaaagcccttgttaagtttgacccggaaattattggtccacgggatattatcaaaattattgaggaaattggctttcatgcttccctggcccagagaaaccccaacgctcatcacttggaccacaagatggaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgtcatggccttaatgatctatatgctgatacccagcaacaagccccaccagtctatggtcctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccaggtcctcggcgggtggtacttctatgttcaggcctacaaatctctgagacacaggtcagccaacatggacgtgctcatcgtcctggccacgagcattgcttacgtctattctctggtcatcctggtggttgctgtggccgagaaggcggagaggagccctgtgacattcttcgacacgcccccgatgctcttcgtgttcattgccttggggcggtggctggaacacttggcaaagagcaaaacctcagaagccctggctaaactcatgtctctccaagccacagaagccactgttgtgacccttggtgaggacaatttaatcatcagggaggagcaagtccccatggagctggtgcagcggggcgatatcgtcaaggtggtccctgggggaaagttcccagtggacgggaaagtcctggaaggcaataccatggctgatgagtccctcatcacaggagaagccatgccagtcactaagaaacctggaagcactgtaattgcggggtctataaatgcacatggctctgtgctcattaaagccacccacgtgggcaatgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcccccattcagcaactggctgaccggtttagtggatattttgtcccgcttatcatcatcatgtcaactttgacgttggtggtatggattgtaatcggttttatcgattttggtgttgttcagaagtactttcctaaccccaacaagcacatctcccagacagaggtgatcatccggtttgcattccagacgtctatcacggtgctatgcattgcctgcccctgctccctggggctggccacgcccacggccgtcatggtgggcactggggtggccgcgcagaatggcatcctcatcaagggaggcaagcccctggagatggcgcacaagataaagactgtgatgtttgacaagactggcaccattacccatggggtccccagggtcatgcgagtgctcctactgggggatgtagccaccctgcccctcaggaaggttctggctgtggtggggactgcggaggccagcagcgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaacttggaacagagaccttgggatactgcacggacttccaggcggtgccagggtgtggaattgggtgcaaagtcagcaacgtggaaggcatcctggcccacagtgagcgccctttgagtgcacctgccagtcacctgaatgaggctggcaaccttcctgcagaaaaagatgcagccccccagaccttctctgtgctgattggaaaccgtgaatggctgaggcgcaacggcttaaccatttccagtgacgtcagtgacgctatgacagaccacgagatgaaaggacagacagccatcctggtggctattgacggtgtgctctgtgggatgattgctatcgcagacgctgtcaagcaggaggccgcactggctgtgcacacgctgcaaagcatgggtgtggacgtggttctgatcactggggacaaccggaagacagccagagccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttcgcacaaggtggccaaggtccaggagctccagaatgaagggaagagagtcgccatggtgggggatgggatcaatgactccccagccttggctcaggcagacatgggtgtcgccattggcaccggcacggatgtggccatcgaggcagccgacgtcgtcctcatcagaaatgatttgctggatgtggtggctagcattcacctttccaagaggattgtccggaggatacgcatcaacctggtcttggcactgatttataacctggttgggatacccatcgcggcaggtgtcttcatgcccatcggcattgtgctgcagccctggatgggctcagcggccatggccgcctcctctgtgtctgtggtgctgtcatccctgcagctcaagtgctataagaagcctgacctggagaggtatgaggcacaggcgcatggccacatgaagcccctgacagcatcccaggtcagtgtgcacatcggcatggatgacaggcggcgggactcccccagggccacaccatgggaccaggtcagctatgtcagccaggtgtcgctgtcctccctgacatctgacaagccatctcggcacagcactgcagcggacgatggtggggacaagtggtctctgctcctgaatgacagggatgaggagcagtacatctgatggcaccaggcaggtgggccagggcagggacttgcctccacttgccacaagctgagcaggacagccaacagcaggatgggctgagctagcctccagctttggggacttccactccctggatatatccagtcatcctgccctgcagcacatggccttgtctgagtgcaactggccttgccctagagaggacggcctggcctgcctcttggcctcactgaaccatcagcatgggctttgtcttggactctagtccttggctgtactgtagaaggtgagagacgagtcaccctcctcacaaacctctgcttggagtatttaggatgactgctgtgaaatggagaacagtttcatcaggaccaaaaaacctcactgggcctttccagagaactgcagacctcactatcaggctctttctgatgacgcctgtctgtgtgcatcatgtttctgagaccacagtttacctcaggtgtgcctgttgctttcttcctgcacagtctgttccttttctctcctgtgtgcttgtccgtggggaccccttggaaccctgcccttcacctaggagggcgagaccaatgtccttgtggtccttgctgctgctctcaggcgcttctccagtgctctggagtgtgcatttcagcttgaacctgcttcctggctcgcacatccccagccagggagcttgccacaccattcttcaggccgaggagagttctttttttgtttaaagtccccttctccatggagtggtggcttctcagtagagtgttgttgctgaccagctggagtgagggtctcagagcctgacctgagagtccagacttggcttcctgtggggtctaggttctcacaattcaggacgtccttccatatccctgcccagcctgtggtgctcaaaacgtttgtcccatgggagacgtgtgtgtgcaggagcctccctgcatggccccaggagcttcgttttcagtcttctgtgtgactgtcacctcgtggggttcaatagagaattcatgtcactagcacctggccttgtgtggcttggagagtaggtactacccaaataggaggaaagcacagcctccttgagcctgccttctgcatgcacccaggggcttcaggaaaggagtggccacagcatcccgaagggagcatctgtttacctggcagtggctctcagagcagcagaaggggtccagttttagactctgaagttggttgtgattgatagaaccccttgggagcaaactagtagagttggattaaattctgggtgaaaccctttgcttccacacaaaatagttttagtgacttttttcagtgtccattacttgccaggggcagttttagcagcactttcgatagattacctctaatcttcccaaccaaccaacaaggtagctattactgtccgcattttacaggcaaggaaacaggctccaagaggctgagggctttgcccaggatgacatagccagtggacaagccgtgtctgtcagctgtgaaggcttcactctaattgtccttctaccttgaacagaagttttcctgataagaataaacaaggaaaaggtccttgcctcctggaagaacaaatctaccaggtgatctattcattgtttcaactcagaatgcaattcattcgggaggtcatctgaccttcaccttgaatggttagtttcactttttacatatagtttttgcagggttttattttataaaatccaagcgccccggtgattgtgttttcattgttttcagccccccaactccagcccgcagcacatttccgctatccgtcagtaactgtgtcctctctttatgcttgcttggggaatgttgttttctgactaggctgatcattatctaaagaatctaattctgttcatttttaaaacttttaggaccataaacattgtgttcctatatggacatggaaatatttatataattttatagaaaataaccttttagatggtcaaagtgtaaggaatttttttgtcagataaccatttctacttcaaaaacatttcatgcattattagaataaagttcttgtcattcctct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]