GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 16:14:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_010136884            1869 bp    mRNA    linear   VRT 06-NOV-2014
DEFINITION  PREDICTED: Buceros rhinoceros silvestris copper-transporting ATPase
            2-like (LOC104494096), partial mRNA.
ACCESSION   XM_010136884
VERSION     XM_010136884.1
DBLINK      BioProject: PRJNA266010
KEYWORDS    RefSeq.
SOURCE      Buceros rhinoceros silvestris
  ORGANISM  Buceros rhinoceros silvestris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Bucerotiformes; Bucerotidae;
            Buceros.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_010413760.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Buceros rhinoceros silvestris
                                           Annotation Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..1869
                     /organism="Buceros rhinoceros silvestris"
                     /mol_type="mRNA"
                     /isolate="BGI_N320"
                     /sub_species="silvestris"
                     /db_xref="taxon:175836"
                     /chromosome="Unknown"
                     /sex="male"
     gene            1..>1869
                     /gene="LOC104494096"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 Proteins"
                     /db_xref="GeneID:104494096"
     CDS             1..>1869
                     /gene="LOC104494096"
                     /codon_start=1
                     /product="copper-transporting ATPase 2-like"
                     /protein_id="XP_010135186.1"
                     /db_xref="GeneID:104494096"
                     /translation="
MERKLDNKMKRDLSCLATLSSKNITLVSVCKQQAAHDVPELLIIDEKSKAESLVTANSKSQNEEKHLQSYSMGMPEVSTVERQALSNTDSPPGCELEPTMKHRFAFDNMGYEESFETIPSSQECTVAVNVVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSEISPEQICQEIQDMGFDANTAEERLTTAVNSSCLKEAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAVIAYCPHIIKPDDLKSHITNLGYDCSIKSKSAPLKLGVLNLQRLQNANPKETPESLESDGVDLLVAEMGSTATVAVQIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKCAVVQYSPNLITLSALQQAIESLPPGNFKVCLLKGSEANKGASPSPALLCNLFREPLEDTTCTAVIRIDGMTCNSCVQSIEGTISQRQGVQCIAVSLSGRTGTIHYNPAVTNGEELRAAIEDMGFDASVLTDTATGGHGHQPDASNAVVQPRVPEPPRQGCASDALPDSARLDGPSQPSRATAEKCFLQIIGMTCASCVSTIERNLQKEVGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQKLGFEATVIEDHAETEGNVELL"
     misc_feature    382..567
                     /gene="LOC104494096"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(397..405,412..414)
                     /gene="LOC104494096"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    631..822
                     /gene="LOC104494096"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(649..657,664..666)
                     /gene="LOC104494096"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    970..1143
                     /gene="LOC104494096"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(985..993,1000..1002)
                     /gene="LOC104494096"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1267..1458
                     /gene="LOC104494096"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1285..1293,1300..1302)
                     /gene="LOC104494096"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1636..1824
                     /gene="LOC104494096"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1651..1659,1666..1668)
                     /gene="LOC104494096"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
ORIGIN      
atggagagaaaactggacaataaaatgaaaagggacctgtcctgcttagctactttaagcagcaaaaacatcaccctggtgtctgtttgtaagcagcaggcagctcacgatgtgcctgaactactgattattgatgaaaagtccaaggcagaatctctggtaacagcaaacagtaagtcacagaacgaagagaaacatttgcagagttactccatgggaatgccagaagtcagcacagttgaaagacaggctttgtccaacaccgattctcctcctggctgtgagctggagcctacaatgaaacaccgttttgcttttgacaacatgggctatgaggagagctttgaaaccattccatcttcccaagagtgcactgtggcagtcaatgttgtgggaatgacttgccaatcatgtgtgcagtcaatagagggccgaatttccaaggtgaagggcattgtcagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgcagtcggaaataagtcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacacagcagaagagaggttgacaacagcagtaaattcgtcatgcttgaaagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcatgcgtcaccaacattgaaggaaagattaggaaactacatggtgtggcgaaaatcaaggtgtcactcggtaaccaggaagcagttattgcttactgtcctcacatcattaagcctgacgacctcaagagccatatcactaacttgggctatgactgctccattaaaagtaaatcagcccctttgaagctgggtgtcctcaatctccagcgcttgcagaatgcaaaccccaaggagacaccagaaagtctcgagagtgatggggtggatctgctggtcgccgagatgggtagcacagctacggtggctgtgcagatagagggcatgcactgtaagtcctgcgtcagaaacattgaaggaaatatatcggatcttcctggcatacaaagtattaaagtatctttggagcataaatgtgctgtggtacagtatagcccaaatttaattaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaaaggttcagaagcaaataaaggagcatctccatcacctgctttgctatgcaatctcttcagagagccactggaagacacaacatgcacggctgttattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagcgacaaggagtgcaatgtatagcagtttctctgtctggcagaactgggaccatacattataatccagctgttactaacggagaagagttaagagctgccatagaagacatggggtttgatgcttctgtgctaacagatacagccactggaggacatgggcaccagcctgatgccagcaatgctgtggtgcagcctcgagttccagagcctcctcgccaaggatgtgcctcagatgctcttccagacagtgctcgccttgatgggccaagccagcccagcagagcgacagctgaaaagtgttttttacaaatcataggcatgacctgtgcatcgtgtgtgtctaccatagaaagaaatttgcagaaagaagtcggaattgtttcagtgttggtagcactgatggcaggtaaggctgagataaagtacaagccagaattgatccagcctcttgaaatagcacagctgatccagaagttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]