ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-15 15:35:59, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_009474019 2793 bp mRNA linear VRT 06-OCT-2014 DEFINITION PREDICTED: Nipponia nippon argonaute RISC catalytic component 2 (AGO2), transcript variant X2, mRNA. ACCESSION XM_009474019 VERSION XM_009474019.1 DBLINK BioProject: PRJNA253829 KEYWORDS RefSeq. SOURCE Nipponia nippon (crested ibis) ORGANISM Nipponia nippon Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Aequornithes; Pelecaniformes; Threskiornithidae; Nipponia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_009002891.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Nipponia nippon Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2793 /organism="Nipponia nippon" /mol_type="mRNA" /isolate="BGI_Y956" /db_xref="taxon:128390" /chromosome="Unknown" /sex="male" /geo_loc_name="China" gene 1..2793 /gene="AGO2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 ESTs, 37 Proteins" /db_xref="GeneID:104020582" CDS 115..2529 /gene="AGO2" /codon_start=1 /product="protein argonaute-2 isoform X2" /protein_id="XP_009472294.1" /db_xref="GeneID:104020582" /translation="
MDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVAIKWMSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLAGELNGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTELPIQGQPCFCKYAQGADSVEPMFRHLKNTYTGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA"
misc_feature 250..474
/gene="AGO2"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 502..654
/gene="AGO2"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 655..1020
/gene="AGO2"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(811..813,856..858,901..903,913..915,967..969,
988..990,994..996)
/gene="AGO2"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1153..2400
/gene="AGO2"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1534..1536,1546..1548,1582..1593,1600..1602,
1624..1626,1633..1635,1645..1647,1657..1659)
/gene="AGO2"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(1738..1740,1744..1746,1954..1956,2368..2370)
/gene="AGO2"
/note="active site"
/db_xref="CDD:240015"
ORIGIN
gcacctcctccaccgttgccaccaccaatacagggatatgcctttaaaccccctcctcgacctgattttggcacttctgggagaacaatcaaactgcaggccaacttctttgaaatggacattcctaaaatagatatctaccattacgaattggatataaagccagaaaaatgccctagaagagttaacagagaaatagtggagcatatggttcagcactttaaaacccagatttttggggatcgcaaaccagtgtttgatggaagaaaaaacctttacacagctatgccacttcccattgggagagataaagtggagctggaggtcacgctgccaggagaaggaaaggacagaatatttaaggtggctataaagtggatgtcctgtgtgagtttgcaggctttacacgatgctctttctggtcggctgccaagtgtcccgtttgaaaccatccaggcactggatgtagtgatgaggcacttgccttccatgagatatactcctgtggggcgatctttttttacagcatcagaagggtgctcaaatccattgggtggtggcagagaagtttggtttggcttccatcaatcagtcagaccttcgttatggaaaatgatgttaaatattgatgtatctgcaaccgcattttacaaagcacagccagttattgagtttgtatgtgaagttttggacttcaaaagtattgaagaacaacaaaaacctctgacagattcccaaagggtaaagtttaccaaagaaataaaaggtctaaaggtggagataacacactgtggacaaatgaaaagaaagtacagagtgtgtaatgtcaccagacgaccagcaagtcaccaaacattcccacttgccggagaattgaatggacaaacagttgaatgcactgtagctcagtattttaaggacaggcacaaattagttttacgctatcctcaccttccatgtttacaagttggacaggagcagaaacacacataccttcctcttgaggtgtgcaacatagtggcaggacaaagatgcataaagaaactcactgacaatcaaacttccactatgattcgagcaactgccagatcggcacctgaccgtcaagaagagattagcaaattgatgcggagtgcaagttttaataccgacccttatgttcgtgaatttggaataatggtcaaagacgaaatgacagatgtgaccggtagagtcctgcagcctccctcaatcctctatggaggcaggaataaagcaattgctacaccagttcaaggagtctgggacatgaggaataaacagtttcacactggaattgaaataaaggtttgggcaattgcgtgctttgctccccagcgccaatgcactgaagttcatcttaagtcctttacagaattgccaatccaggggcagccatgcttctgcaaatacgcgcagggagctgacagtgtggagcccatgttcagacatctcaagaacacttatactgggctgcagcttgttgtagtaattttgccaggaaaaacgccagtctatgccgaggtgaagcgtgttggcgacactgtgctgggaatggctacacagtgcgttcagatgaaaaacgtgcaaagaacaacaccgcaaactctgtctaacctttgcttaaaaataaatgtcaaattaggaggcgtaaataatattttactgcctcagggaagaccaccagtatttcagcagcctgtcatattccttggtgcagatgtaactcatccgccagctggagatggaaaaaagccttccattgctgcagttgtaggaagcatggatgctcatcctaatcgatattgtgccactgttcgggtccagcagcaccgccaagaaatcattcaagatttggctgccatggtcagggagctgctcattcagttttacaaatcaaccagatttaaaccaactcgtataatcttctacagagatggtgtttctgaggggcagtttcaacaggttctccatcatgaattgctggctatcagagaagcatgcattaaactagaaaaggattaccagcctggaattacatttatagttgtgcagaaaaggcatcacaccagactcttctgtacagacaaaaacgaacgggttggaaaaagcggaaacattccagcgggtaccacagtggacacaaaaatcacccatccgtcagagtttgacttttacctgtgtagtcatgctggtattcagggaacaagcagaccttctcattaccatgtcctctgggatgacaatcgtttctcttcagatgaacttcagattcttacctaccagctgtgtcatacgtacgtacgctgtactcgttctgtttccatccctgcaccagcatattacgcgcacctggttgccttcagagccaggtatcatctggtggataaagaacacgatagtgctgaaggaagccacacttctggtcagagtaatggcagagatcatcaagcacttgctaaagcagttcaagttcatcaggacacgttgcgcactatgtactttgcttgacatgttttaatgtttagcgactgagtacaatacagagttggattcacatgagaccagctgcacttagaccaacagttgcccaagctacagtgacagccagcaatgagtgatgcatcttaatttttattttttttcccctttgcaagaaagccttccgtccagaatttcagacttgattacgaactgcattcttgtaccaaaccccactattgttggaaatgtggtttgccaaaaatctctaagctgcttggtataaaacagacc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]