GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-15 15:12:01, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_009474018            2799 bp    mRNA    linear   VRT 06-OCT-2014
DEFINITION  PREDICTED: Nipponia nippon argonaute RISC catalytic component 2
            (AGO2), transcript variant X1, mRNA.
ACCESSION   XM_009474018
VERSION     XM_009474018.1
DBLINK      BioProject: PRJNA253829
KEYWORDS    RefSeq.
SOURCE      Nipponia nippon (crested ibis)
  ORGANISM  Nipponia nippon
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Aequornithes;
            Pelecaniformes; Threskiornithidae; Nipponia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_009002891.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nipponia nippon Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2799
                     /organism="Nipponia nippon"
                     /mol_type="mRNA"
                     /isolate="BGI_Y956"
                     /db_xref="taxon:128390"
                     /chromosome="Unknown"
                     /sex="male"
                     /geo_loc_name="China"
     gene            1..2799
                     /gene="AGO2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, 7 Proteins"
                     /db_xref="GeneID:104020582"
     CDS             115..2535
                     /gene="AGO2"
                     /codon_start=1
                     /product="protein argonaute-2 isoform X1"
                     /protein_id="XP_009472293.1"
                     /db_xref="GeneID:104020582"
                     /translation="
MDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVAIKWMSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLAGELNGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLVSMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTELPIQGQPCFCKYAQGADSVEPMFRHLKNTYTGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA"
     misc_feature    250..474
                     /gene="AGO2"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    502..654
                     /gene="AGO2"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    655..1020
                     /gene="AGO2"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(811..813,856..858,901..903,913..915,967..969,
                     988..990,994..996)
                     /gene="AGO2"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1159..2406
                     /gene="AGO2"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1540..1542,1552..1554,1588..1599,1606..1608,
                     1630..1632,1639..1641,1651..1653,1663..1665)
                     /gene="AGO2"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1744..1746,1750..1752,1960..1962,2374..2376)
                     /gene="AGO2"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcacctcctccaccgttgccaccaccaatacagggatatgcctttaaaccccctcctcgacctgattttggcacttctgggagaacaatcaaactgcaggccaacttctttgaaatggacattcctaaaatagatatctaccattacgaattggatataaagccagaaaaatgccctagaagagttaacagagaaatagtggagcatatggttcagcactttaaaacccagatttttggggatcgcaaaccagtgtttgatggaagaaaaaacctttacacagctatgccacttcccattgggagagataaagtggagctggaggtcacgctgccaggagaaggaaaggacagaatatttaaggtggctataaagtggatgtcctgtgtgagtttgcaggctttacacgatgctctttctggtcggctgccaagtgtcccgtttgaaaccatccaggcactggatgtagtgatgaggcacttgccttccatgagatatactcctgtggggcgatctttttttacagcatcagaagggtgctcaaatccattgggtggtggcagagaagtttggtttggcttccatcaatcagtcagaccttcgttatggaaaatgatgttaaatattgatgtatctgcaaccgcattttacaaagcacagccagttattgagtttgtatgtgaagttttggacttcaaaagtattgaagaacaacaaaaacctctgacagattcccaaagggtaaagtttaccaaagaaataaaaggtctaaaggtggagataacacactgtggacaaatgaaaagaaagtacagagtgtgtaatgtcaccagacgaccagcaagtcaccaaacattcccacttgccggagaattgaatggacaaacagttgaatgcactgtagctcagtattttaaggacaggcacaaattagttttacgctatcctcaccttccatgtttacaagttggacaggagcagaaacacacataccttcctcttgaggtgtgcaacatagtggcaggacaaagatgcataaagaaactcactgacaatcaaacttccactatgattcgagcaactgccagatcggcacctgaccgtcaagaagagattagcaaattggtgagtatgcggagtgcaagttttaataccgacccttatgttcgtgaatttggaataatggtcaaagacgaaatgacagatgtgaccggtagagtcctgcagcctccctcaatcctctatggaggcaggaataaagcaattgctacaccagttcaaggagtctgggacatgaggaataaacagtttcacactggaattgaaataaaggtttgggcaattgcgtgctttgctccccagcgccaatgcactgaagttcatcttaagtcctttacagaattgccaatccaggggcagccatgcttctgcaaatacgcgcagggagctgacagtgtggagcccatgttcagacatctcaagaacacttatactgggctgcagcttgttgtagtaattttgccaggaaaaacgccagtctatgccgaggtgaagcgtgttggcgacactgtgctgggaatggctacacagtgcgttcagatgaaaaacgtgcaaagaacaacaccgcaaactctgtctaacctttgcttaaaaataaatgtcaaattaggaggcgtaaataatattttactgcctcagggaagaccaccagtatttcagcagcctgtcatattccttggtgcagatgtaactcatccgccagctggagatggaaaaaagccttccattgctgcagttgtaggaagcatggatgctcatcctaatcgatattgtgccactgttcgggtccagcagcaccgccaagaaatcattcaagatttggctgccatggtcagggagctgctcattcagttttacaaatcaaccagatttaaaccaactcgtataatcttctacagagatggtgtttctgaggggcagtttcaacaggttctccatcatgaattgctggctatcagagaagcatgcattaaactagaaaaggattaccagcctggaattacatttatagttgtgcagaaaaggcatcacaccagactcttctgtacagacaaaaacgaacgggttggaaaaagcggaaacattccagcgggtaccacagtggacacaaaaatcacccatccgtcagagtttgacttttacctgtgtagtcatgctggtattcagggaacaagcagaccttctcattaccatgtcctctgggatgacaatcgtttctcttcagatgaacttcagattcttacctaccagctgtgtcatacgtacgtacgctgtactcgttctgtttccatccctgcaccagcatattacgcgcacctggttgccttcagagccaggtatcatctggtggataaagaacacgatagtgctgaaggaagccacacttctggtcagagtaatggcagagatcatcaagcacttgctaaagcagttcaagttcatcaggacacgttgcgcactatgtactttgcttgacatgttttaatgtttagcgactgagtacaatacagagttggattcacatgagaccagctgcacttagaccaacagttgcccaagctacagtgacagccagcaatgagtgatgcatcttaatttttattttttttcccctttgcaagaaagccttccgtccagaatttcagacttgattacgaactgcattcttgtaccaaaccccactattgttggaaatgtggtttgccaaaaatctctaagctgcttggtataaaacagacc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]