LOCUS       XM_009463068            4882 bp    mRNA    linear   VRT 06-OCT-2014
DEFINITION  PREDICTED: Nipponia nippon ATPase, Cu++ transporting, beta
            polypeptide (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_009463068
VERSION     XM_009463068.1
DBLINK      BioProject: PRJNA253829
KEYWORDS    RefSeq.
SOURCE      Nipponia nippon (crested ibis)
  ORGANISM  Nipponia nippon
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Aequornithes;
            Pelecaniformes; Threskiornithidae; Nipponia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008999791.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Nipponia nippon Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4882
                     /organism="Nipponia nippon"
                     /mol_type="mRNA"
                     /isolate="BGI_Y956"
                     /db_xref="taxon:128390"
                     /chromosome="Unknown"
                     /sex="male"
                     /geo_loc_name="China"
     gene            1..4882
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 10 Proteins"
                     /db_xref="GeneID:104010884"
     CDS             1..4605
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_009461343.1"
                     /db_xref="GeneID:104010884"
                     /translation="

MERKLDNKMKRERSCLATLNNKNITLVSIRKRQAAHDVPELLIIGEKSNTGSPVKASSNLQKEEKLLQSYSTRMPEVNTVERQALSNTDFPPGCELEPTMKHNFAFDNMGYEESFETVSSPSSQEHTVAVNVVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLLSEISPEQICQEIQDMGFDANVAEERLTTATVNLSCLREAVVKLRVEGMTCQSCVTNIEGNVRKLHGVAKIKVSLGNQEAIIAYYPYIIQPHDLKSHISNLGYECTIKSKLAPLKLGVFDLGRLQNANPKETPVSLKSDGVDPLVTKMSGTATVALQIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVLLLKDSEANKGASRSPALLCDLFREPLQDTTWTAVIRIDGMTCNSCVQSIEGTISQRQGVQCIAVSLADRTGTIHYDPGVTNGEELRAAIEDMGFDASVLTDTAAGERRHRPDASNAAMQPQAPEPSRQGCASGALPDSPHLDGPNQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKTIEEIGFHASVARRVPNAHNLDHKREIQQWRKSFLCSLLFGIPVLILMVYMLIPDGEHHGSMVLERNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVMATTIAYVYSCVILMVAIIEKAEKSPITFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIVREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQSKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKILAVVGTAEASSEHPLGVAVTKYCREELGTQSLGYCTDFQAVPGCGISCKVRGVEAVLGTAEEGLDKLDADRSRDSSAPLGDNVGICSFFFLSVSKGPSTSHTYSVLIGNREWMRRNGLHIANDVNDAMTDHEMKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHALKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGCMKPLTPSQISVHIGMDDRRRDSSRLAPWDQISQVSLSSLTSDKLPRRNGFVEEEGDKWSLLMNGADEEQYI"

     misc_feature    388..573
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(403..411,418..420)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    640..831
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(658..666,673..675)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    979..1152
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(994..1002,1009..1011)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1270..1476
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1645..1833
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1660..1668,1675..1677)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1870..2061
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1888..1896,1903..1905)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2125..4278
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3118..3120,3124..3126,4207..4209)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3250..3258,3460..3462,3658..3666,3754..3756,
                     3874..3882,3940..3942,3949..3951,3958..3960,4015..4017,
                     4024..4026)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

atggagagaaaactggacaataaaatgaaaagggaacggtcctgcttagctactttaaacaacaaaaacataaccctggtgtctattcgtaagcggcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaacacaggatctccggtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccacgagaatgccagaagtcaatacagttgaaagacaggctttgtccaacactgattttcctcctggctgtgagctggagcctacaatgaaacacaattttgcttttgacaacatgggctacgaggagagctttgaaactgtgtcctctccatcttcccaagaacacactgtggcagtcaacgttgtgggaatgacttgccaatcttgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattgtgagtattaaagtctcccttgaacagaacaacgctgtgataaagtatctgctgtcggaaataagtcctgaacagatttgccaggaaatccaggatatgggctttgatgccaacgtagcagaagagaggttgacaacagccaccgtaaatttgtcgtgcttgagagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaacgttaggaaactgcatggtgtggcgaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctcacgacctcaagagccatatcagtaacctggggtatgaatgcaccattaaaagtaaattggcccctttgaagcttggtgtctttgatctcgggcgcctgcagaatgcaaaccccaaggagacaccagtaagtctcaagagtgatggggtggatccactggtcaccaagatgagtggcacagctacggtggctctacagatagaaggcatgcactgcaaatcatgtgtcagaaacattgaaggaaatatatcagatcttcccggcatacaaagtattaaagtgtctttggagcataaacgtgctgttgtacagtatagcccaaatttaattaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtacttctccttaaggattcagaagctaataagggagcatctcgatcacctgctttgctatgtgatctcttcagagagccactgcaagacacaacatggacagctgtaattaggattgatggcatgacctgcaattcctgtgtacagtccatagaagggaccatatcacagagacaaggagtacaatgtatagcagtttctctagctgacaggactgggaccatacattatgatccaggtgtcactaatggagaagagttaagagctgccatagaagacatggggtttgatgcttctgtgctgacagataccgccgctggagaacgtaggcaccggcctgatgccagcaacgctgccatgcagcctcaagctccagagccttctcgccaaggttgtgcctcaggtgctcttccagacagtcctcaccttgatgggccaaaccagcccagcggagcaacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcgtcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccaaaatttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgagtccaaactcatgagaacaaatggcatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgggatattataaaaacaattgaggaaattggctttcatgcttccgtggctagaagagttccaaatgcacataacctggatcataaaagggaaatacagcagtggaggaaatctttcttgtgcagcctactgtttggtatccctgtcttaatcctaatggtttatatgctaatacccgacggtgagcaccatgggtctatggtgctggaacggaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgtccagtttcttggtggatggtatttttatgtacaagcttacaaatcgctgaagcacaagacggctaatatggatgtgctcatcgtaatggccacgacgattgcttatgtgtattcctgtgtgatcctgatggtagcgataattgaaaaggcagagaaaagccctatcactttctttgacactcctccgatgctgttcgtgttcattgcccttgggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcgtcagggaggagcaggtagctgttgaactggttcaaaggggtgatattgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgaatctctcattactggggaagctatgccagtcactaaaaagcctggaagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcgaaggcacccatccagcaactggcagataagtttagtggatattttgttccctttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaattttgatgttattcaaaaatattttcctaatcagagcaaacacgtttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcttggctacccccacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggcggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgctattgctgggagacacggctgtgctctctctgaagaagatactggcggtggttggcactgcagaagccagcagcgagcatcctttaggagtggcagtcactaaatattgcagagaggagcttggcactcagagcctaggatactgcaccgacttccaggcagtcccgggctgtggcatcagctgcaaagtcagaggtgttgaggccgtcctgggcacagccgaggagggtctcgataagctggacgctgacaggagcagggacagcagtgctcctctgggagataacgtaggtatttgctcatttttctttttgtctgtgtccaaaggtccatcaacttctcatacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgatgtaaatgatgcaatgacagaccatgaaatgaaaggacagactgccatactggtggctatagatggcgtgttgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcacgcgctgaaaaacatgggaatagatgtggtgctgataactggggacaacagaaaaaccgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcataaggttgcaaaggtccaggagctccaaaatgggaggaggaaggttgcgatggttggtgatggagtcaatgattcccctgcactcgccagggctgatgttggaattgcaattggaacgggcaccgatgttgccattgaagcagcagatgttgttcttatccgaaacgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctcattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggcctcgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacggaaagttatgaagcacaagctcaaggctgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggcggagggattcatccagactggctccttgggatcagattagccaagtgtctctctcttccttgacttcagacaagctgccgagacgtaatggttttgttgaggaggaaggggacaagtggtcattgctcatgaatggagcagatgaagaacagtacatctgaagcactgtattcttagtacaggaggaaatgttcctcctcaccagtgacaggagggaccaacttatgtcatcaagagcttcagggttgtaagtgaagtcattccttcagctcacaaaacaattgcaactcagcttgatgttggactgtatggattgtggatttttttcaggtcaccagttgtttctagtcatggaaagaatttgtggctctataatgaactgtctcctttgcacacatcaattagcgaaataatgtaaaattgtaattttcagagtct

//