GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-05-31 02:56:33, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_009319971            4520 bp    mRNA    linear   VRT 26-SEP-2014
DEFINITION  PREDICTED: Pygoscelis adeliae ATPase, Cu++ transporting, beta
            polypeptide (ATP7B), mRNA.
ACCESSION   XM_009319971
VERSION     XM_009319971.1
DBLINK      BioProject: PRJNA261076
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Pygoscelis adeliae (Adelie penguin)
  ORGANISM  Pygoscelis adeliae
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Aequornithes;
            Sphenisciformes; Spheniscidae; Pygoscelis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008824368.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Pygoscelis adeliae Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 3% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..4520
                     /organism="Pygoscelis adeliae"
                     /mol_type="mRNA"
                     /isolate="BGI_AS28"
                     /db_xref="taxon:9238"
                     /chromosome="Unknown"
                     /sex="male"
                     /geo_loc_name="Antarctica"
     gene            1..4520
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 ESTs, 11 Proteins"
                     /db_xref="GeneID:103913477"
     CDS             4..4242
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_009318246.1"
                     /db_xref="GeneID:103913477"
                     /translation="
MKHNFAFDNMGYEESFETAPSPSSQEHTVAVNVVGMTCQSCVQSIEGRISKVKGIVSIKVSLERNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTATVNLSCLREAVVKLQVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYECTIKSKSAPLKLGVLDLRRLQNANPNETAASLESDGMDPPVSKMSGTATVAVRIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVCLLNGSEVDKGASPSPALLCDLFREPLQDTTCTAVIRIDGMTCNSCVQSIEGTISQRQGVQCIAVSLADRTGSIHYDPAVTNGEELRAAIEDMGFDASVLTDTAAEESRHQPDASNAAVQPRAPEPPRQGCASDALPDSPHLDGPNQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATIIEDHAESEGNVELLITGMTCASCVHNIESKLLRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGAPKVMRVLLLGDPAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVRGVEAILGMAEEGLDKLDTNRSRDSTSHTYSVLIGNREWMRRNGLHIANDINDAMTDHEMKGQTAILVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRMNLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLTSDKLPRHNGFVEEEEDKWSLLMNGGDEEQYI"
     misc_feature    94..279
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(109..117,124..126)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    346..537
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(364..372,379..381)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    685..858
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(700..708,715..717)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    976..1182
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1351..1539
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1366..1374,1381..1383)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1576..1767
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1594..1602,1609..1611)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1831..3915
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2824..2826,2830..2832,3844..3846)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2956..2964,3166..3168,3295..3303,3391..3393,
                     3511..3519,3577..3579,3586..3588,3595..3597,3652..3654,
                     3661..3663)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
acaatgaaacacaattttgcttttgacaacatgggctatgaggagagctttgaaactgcgccctctccatcttcccaagaacacactgtggcagtcaatgttgtgggaatgacttgccaatcttgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattgtgagtattaaagtctcccttgaacggaacaacgctgtaataaagtatctgcagtcagaaataagtcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcggaagagaggctgacaacagcaaccgtaaatttgtcgtgcttgagagaagcagtagttaagcttcaggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcacggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagccatatcagtaacttggggtatgaatgcaccattaaaagtaagtcagcccctttgaagcttggtgtccttgatctcaggcgcctgcagaatgcaaaccccaatgagacagcagcaagtctcgagagcgatgggatggatccaccggtctccaagatgagtggcacagctacggtggctgtacggatagaaggcatgcactgcaaatcctgtgtcagaaacattgaaggaaatatatcagatcttcccggcatacaaagtattaaagtgtctttggagcataaacgtgctgtggtacagtatagcccaaatttaattaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtatgtctccttaatggttcggaagttgataagggagcatctccatcacctgctttgctgtgtgatctcttcagagagccgctgcaagacacgacatgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaagggaccatatcacagagacaaggagtgcaatgtatagcagtttctctagctgacagaactgggagcatacattatgatccagctgtcactaatggagaagagttaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatactgccgctgaagaaagtaggcaccagcctgacgccagtaatgctgctgtgcaacctcgagctccagagcctcctcgccaaggctgtgcctcagatgctcttccagacagtcctcaccttgatgggccaaaccagcccagcggagcgacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcatcatgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaatttgggctttgaagctaccatcatagaagatcatgcagaatcagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcctgagaacaaatggcatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactgggcctcgagatattataaaaataattgaggaaattggctttcatgcttccgtggctagaagagttccaaatgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcttgtgcagcctactgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgacggtgagcaccatgggtctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttacgtacaagcttacaaatcactgaagcacaaaacggccaatatggatgtgctcatcgtactggccacaacgattgcttatgtgtattcgtgtgtgatcctgatggtagcgataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccgatgctgtttgtgttcattgcccttgggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtagtgactctcggacctgaccactctattgtcagggaggagcaggtagctgttgaactggttcaaaggggtgatattgtaaaggttgttcctggtggaaagttcccggtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcatcactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaattttgatgttattcaaaaatattttcctaatcagaacaaacacgtttcaaaagctgaactaatactgaggtttgcatttcaaacctcgatcactgtgctgagcattgcatgcccctgttctttaggcttggctacccccacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgcggagctcctaaagtcatgagggtgcttttgctgggagacccagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggcactcagagcctgggatactgcaccgacttccaggcagtcccgggctgtggcatcagctgcaaagtcagaggtgttgaggccatcctgggcatggccgaggagggtctcgataagctggacactaacaggagcagggacagcacttctcatacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcgatgacagatcatgaaatgaaaggacagactgccatactagtggctatagatggcatgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggcagcccttgctgtgcacacactgaaaaacatgggaatagatgtggtgctgataacgggggacaacagaaaaacggcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaggtccaggagctccaaaatgggaggaggaaggttgcgatggttggtgatggagtcaatgattcccctgcactagccagggctgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagcagatgttgttcttatccgaaatgacttactggatgtagttgccagtattcacttatcaaagagaacggttcgaagaatacgaatgaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcaaccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttatgaagcacaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccggctccatgggatcagattagccaagtgtctctctcttccttgacttcagacaagctgccaagacataatggttttgttgaggaggaagaggacaagtggtcattgctcatgaatggaggagatgaagaacagtacatctgaagcactgcattcttagtacaggaggaaacattcctcctcaccggtgacgggagggactgacttaatgtcgtcaagagctccaaggttgtaagtgaagtcatttctttagctcacaaaacaattgctactcagctcaatgttcagttgtatggactgtggatttttttcaggtcaccagttatttctagtcacagaaagaatctgtggctctacaatgaactgactcctttgcacacagcaattagtgaaataatgtaaaattgtaattttcagagtct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]