ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-11-15 14:12:49, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_009082080 2428 bp mRNA linear VRT 05-SEP-2014 DEFINITION PREDICTED: Acanthisitta chloris argonaute RISC catalytic component 4 (AGO4), partial mRNA. ACCESSION XM_009082080 VERSION XM_009082080.1 DBLINK BioProject: PRJNA253841 KEYWORDS RefSeq. SOURCE Acanthisitta chloris (rifleman) ORGANISM Acanthisitta chloris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Passeriformes; Acanthisittidae; Acanthisitta. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_008691020.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Acanthisitta chloris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..2428 /organism="Acanthisitta chloris" /mol_type="mRNA" /isolate="BGI_N310" /db_xref="taxon:57068" /chromosome="Unknown" /sex="female" /geo_loc_name="New Zealand" gene 1..>2428 /gene="AGO4" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 24 Proteins" /db_xref="GeneID:103809253" CDS 182..>2428 /gene="AGO4" /codon_start=1 /product="protein argonaute-4" /protein_id="XP_009080328.1" /db_xref="GeneID:103809253" /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSIQWVSVVSLQMLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNISEQSKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRAR"
misc_feature 191..445
/gene="AGO4"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 476..628
/gene="AGO4"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 629..991
/gene="AGO4"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(785..787,830..832,872..874,884..886,938..940,
959..961,965..967)
/gene="AGO4"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1130..2428
/gene="AGO4"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1541..1543,1553..1555,1589..1600,1607..1609,
1631..1633,1640..1642,1652..1654,1664..1666)
/gene="AGO4"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(1745..1747,1751..1753,1991..1993,2405..2407)
/gene="AGO4"
/note="active site"
/db_xref="CDD:240015"
ORIGIN
gcccccagcgagtctcttccagccgccgcgccgccccggcctgggcaccgtggggaaacccattcgcctcctggccaaccacttccaggtgcagatcccgaagattgatgtgtatcactatgatgtggatatcaaaccagagaaacggccccgaagagtcaacagggaggtggtggataccatggtgaggcacttcaagatgcagatatttggggatcggcagcccgggtatgatgggaagaggaacatgtacacggcacacccgttacccatcggcagggacagggtggatatggaggtgacacttccaggagaggggaaggaccagacgttcaaggtttccattcagtgggtgtcggtcgtcagccttcagatgctgctggaagctctggcaggacacttgaatgaagttcctgaagattctgtacaggcactggatgtgatcacacggcaccttccctccatgaggtacacccctgtgggtcgctccttcttctccccccctgaaggctactaccaccccctgggagggggcagggaggtctggttcgggttccaccagtcggtccgacctgccatgtggaacatgatgctcaacatcgacgtgtcagcaactgctttctatcgtgcccagcctatcattgagttcatgtgtgaggtcttggacatccagaacatcagtgagcagagcaaacctctgacagactcccagcgcgtcaagtttaccaaagaaatcagaggtctcaaggtggaggttacccactgtggccagatgaagaggaaataccgagtttgcaacgttacacggcgaccggcgagtcaccagacgttccctctgcagctggagaatgggcaggccatggagtgcacggtggctcagtacttcaagcagaagtacagcctgcagctgaaataccctcacctgccctgcctgcaggtggggcaggagcagaagcacacgtacctgcccctggaggtgtgtaacatcgtggcaggccagagatgcatcaagaagctcacggacaatcagacttcgaccatgatcaaagcgacagccaggtctgccccggacaggcaggaggagatcagcagactggtgaagagcaacagcatggtgggtggccctgacccgtacctgaaggagtttggcattgttgtccataacgaaatgacagagctgacaggcagagtgctgccagccccaatgctgcagtatggaggcaggaacaagactgtggccacaccaaaccaaggcgtgtgggacatgagggggaaacagttctacgccggcattgagattaaagtctgggctgtggcctgttttgctcctcagaaacaatgcagggaagacttgctgaagagtttcaccgaccaactgcgcaagatctccaaggacgctgggatgcccatccagggccagccctgcttctgcaagtatgcccaaggggcagacagcgtggagcccatgttcaagcacctgaagctgacctacgtggggctgcagctcatcgtggtgatcctgcctgggaagacacccgtgtacgctgaagtcaagcgggttggagacactcttctaggcatggccacacagtgtgtgcaggtaaagaatgtggtcaaaacctcaccacagacactgtccaacctgtgtctgaagatcaacgcgaagcttggagggatcaacaacgtgctggtacctcatcaaaggccctcggtgttccagcagccagtgatcttcctgggggcagacgtgacccaccctccagccggggacgggaagaagccgtcgatcgcggccgtggtgggcagcatggacgggcaccccagccgctactgcgccacggtgcgcgtgcagacctcgcgccaggagacctcccaggagctgctctacagccaggaggtcatccaggacctcaccaacatggtgagggagctcctgatccagttctacaaatccacacgcttcaagcccaccaggatcatctactacagagggggagtgtcggaaggacagatgaaacaggtggcctggcccgagctgatcgccatcaggaaggcctgcatcagtttggaggaggactacagaccaggaataacctacatcgtggtgcagaagaggcaccacaccaggctcttctgtgctgacaaaaccgagagggtgggtaagagcggcaacgtaccagcagggactactgtggacagcaccatcacacatccctcggaatttgacttttacctctgtagccatgcaggaattcagggaaccagccgtccctcccactaccaggtgttgtgggatgacaactgcttcacggcggacgagctgcagctgctgacctaccagctgtgccacacctacgtgcgctgcacgcgctccgtctccatccccgcgcccgcctactacgctcacctggtggccttcagggccagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]