2024-05-15 17:55:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_008992920 3555 bp mRNA linear PRI 18-MAR-2023 DEFINITION PREDICTED: Callithrix jacchus nuclear factor kappa B subunit 1 (NFKB1), transcript variant X2, mRNA. ACCESSION XM_008992920 VERSION XM_008992920.4 DBLINK BioProject: PRJNA939228 KEYWORDS RefSeq. SOURCE Callithrix jacchus (white-tufted-ear marmoset) ORGANISM Callithrix jacchus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Cebidae; Callitrichinae; Callithrix; Callithrix. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_071444) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 18, 2023 this sequence version replaced XM_008992920.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_011100555.1-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3555 /organism="Callithrix jacchus" /mol_type="mRNA" /isolate="mCalJac1" /db_xref="taxon:9483" /chromosome="3" /sex="male" /tissue_type="muscle" /dev_stage="juvenile" /country="USA: New York" /lat_lon="40.762676 N 73.955541 W" /collection_date="2018-06-12" /collected_by="Stephanie Marcus and Margaret Fabiszak" gene 1..3555 /gene="NFKB1" /note="nuclear factor kappa B subunit 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 mRNAs, 256 ESTs, 3 long SRA reads, 5 Proteins" /db_xref="GeneID:100415321" CDS 148..3054 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X2" /protein_id="XP_008991168.1" /db_xref="GeneID:100415321" /translation="
MAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGSGGGGTGSTGPGYSFPHYGFPTYGGISFHPGTTKSNAGMKHGAMDSESKTDPEGCDKSDDRDTVNLCRKVTETTEQDQEPSKATDGNGEVTLTYATGTKEENAEVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDYPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVSGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 271..876 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(313..315,319..324,328..333,340..351,574..576, 580..585,874..876) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 895..1200 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(898..900,904..912,916..924,1042..1050,1087..1089, 1123..1125,1180..1182,1189..1191,1195..1197) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(904..909,913..915,952..954,958..960,964..966, 1063..1068,1075..1077,1081..1083) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(967..969,973..975,1066..1071) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature order(1771..1773,1777..1779,1789..1794,1801..1809, 1813..1818,1828..1830,1837..1839,1882..1884,1888..1890, 1894..1896,1906..1911,1918..1926,1930..1935,1945..1947, 1954..1956,1981..1983,1987..1989,1993..1995,2005..2010, 2017..2025,2029..2034,2044..2046,2053..2055) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1771..1884 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1774..>2343 /gene="NFKB1" /note="Transient Receptor Potential channel, Vanilloid subfamily (TRPV); Region: TRPV; cl40437" /db_xref="CDD:454755" misc_feature 1888..1983 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1903..2187 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 2197..2286 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2590..2817 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" polyA_site 3555 /gene="NFKB1" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
ctcgctcgccccgacccgcacccgggcccgctcgggctccggccggccgccgcctcttccttctccagctcttaggcccgcgccgcccgggagggagagcccacccgcgacaggaagccgaacgctgactcgccacccggtttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtctgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgctcacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcatgtataaggggctacaatcctgggctcttggtgcaccctgaccttgcgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttaaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagataaagaagaagtgcagaggaaacgacaaaagctcatgcccaatttttcggatagtttcggcggtggtagtggtgctggagctggaggtggaggcatgtttggtagtggcagtggaggagggggcactggaagtacaggtccagggtatagcttcccacactatggatttcctacttatggagggatttccttccatcctggaactactaaatctaatgctgggatgaaacatggagccatggacagtgaatctaaaacggaccctgaaggttgtgacaaaagtgatgatagagacactgtaaacctctgtagaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccactgatgggaatggtgaggtcactctaacgtatgcaacaggaaccaaagaagagaatgctgaggttcaggataacctctttctagagaaggctatgcagcttgcgaagaggcatgccaatgcccttttcgactatgcagtgacaggagatgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactggaagtcacgtctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggccggggccgacctgagccttctggaccgcttcggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgactaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtccggacgcacagcactgcacctagctgtggagcacgacaacatctcattggctggctgcctgctccttgagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcggcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtatctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctaccctggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacactgaagcaattgaagtgatccaggcggcctccagcccagtgaagaccacctcgcaggcccactcgctgcctctctcgcctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaagctcagctttaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccgtgtaaaccaaagccctgaaattccactgtatcgtccacaagaagaaagctgaagcgcatccaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagtggatgcatctggggatgaggctgcttactgagctttgccggccactgctggatcacagctgctttctgttgtcattgttatttcccctctgctacgttcctgttttcattaaaggtatcactgtccccacctggcattccttctgaccatccatagcatcgttttgcattcaaattaagtgttaagaaagggatattttaaaatgagaatcacttgatgtgcaattttaaaaaaggcgtattactttttctaatgtggttatttctctgattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]