LOCUS       XM_008677110            1573 bp    mRNA    linear   PLN 31-AUG-2020
DEFINITION  PREDICTED: Zea mays protein argonaute 1B (LOC103651475), transcript
            variant X1, mRNA.
ACCESSION   XM_008677110
VERSION     XM_008677110.4
DBLINK      BioProject: PRJNA655717
KEYWORDS    RefSeq.
SOURCE      Zea mays
  ORGANISM  Zea mays
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
            Zea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_050098.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 31, 2020 this sequence version replaced XM_008677110.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Zea mays Annotation Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1573
                     /organism="Zea mays"
                     /mol_type="mRNA"
                     /cultivar="B73"
                     /db_xref="taxon:4577"
                     /chromosome="3"
     gene            1..1573
                     /gene="LOC103651475"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 14 long SRA reads, and 89%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 58 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:103651475"
     CDS             530..1369
                     /gene="LOC103651475"
                     /codon_start=1
                     /product="protein argonaute 1B isoform X1"
                     /protein_id="XP_008675332.1"
                     /db_xref="GeneID:103651475"
                     /translation="

MCREHKKTDVQSILVTADILAGRQADAPQEALQVLDIVLRELPTARYSPVGRSFYSPNLGRRQKLGEGLESWRGFYQSIRPTQMGLSLNIDMSSTAFIEPLPVIDFVAQLLNRDISVRPLSDSDRVKIKKALRGVKVEVTGNMRRKYHISGLTSQATRELSFPVDDRGTVKTVVQYFMETYGFSIQHTTLPCLQVGNQQRPNYLPMEVCKIVEGQHYSKRLNEKQITALLKVTCQRPQERELDILQDSGSHQVTPPPHDDFADKCLHSSGGAMNNNPMS"

     misc_feature    677..826
                     /gene="LOC103651475"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    827..1165
                     /gene="LOC103651475"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(968..970,1013..1015,1046..1048,1058..1060,
                     1112..1114,1133..1135,1139..1141)
                     /gene="LOC103651475"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      

ttcttttccctctatcgacaccgtgcgcgcacccgcagctacctgcctcgccgccgccctcatacacgcagcgcttcccgccaccgtgcgccttgcacagcggcgtgctgccttcggcacccttgccgcacccctcgaagacgcagcgcttcccgtcgccgtgcgatttgcagtacagggtgctgccctgcgctcccctgcggcagtccgggaactggcaccagctcgcgcgccgccaccagcgcggcccatcctcgccaccccgcggccccccgccgccaccagaaaccggccacgcgtgcccctccgccaccccgcgcgcgccccgctgctccaccgcgcaccaccccgacatggctgaagatgacatggaactatggaagtgggtgttgcttccgaggatcaggacagtgacgacgatgttgatgaggatagaaaggaacaaatttctcattgattttttgagttgggaagtggcaaccacacttcaagtggtggtgctcgtacatctctttgttggactgcatgaatgtgcagggaacacaaaaaaacagatgtacaatcaatcctggtgacagctgatattctagctggaaggcaagcagatgcccctcaggaagctcttcaagtgcttgacattgtactacgtgaattgcctaccgcgaggtattctcctgttggtaggtcattttactctcccaacttagggagacgtcaaaaacttggtgagggattagaaagttggcgtggtttttaccaaagcataaggccgacacagatgggcctttcactgaatattgatatgtcctctactgcatttatcgagcctctccctgtgattgattttgttgctcagcttcttaacagagatatctcagttagaccattatctgattctgatcgcgtgaagattaaaaaagccctaagaggtgtgaaggttgaggtgactggaaacatgcgcagaaaatatcacatttctggcctcacctcacaagcaacaagagagctatcattccctgttgatgatcgtggtactgtgaagactgtggtgcaatacttcatggagacttatggttttagtatccagcacaccactttaccatgcttgcaagtgggcaatcaacaaagaccaaattatctgcctatggaggtttgcaagatagttgaaggacagcattactcaaagagactcaatgagaaacaaatcactgctctactgaaagtgacctgccagcgccctcaagagcgtgagctggacatcttacaggattccggctctcatcaagtgactcctccccctcacgatgactttgcggacaaatgtctccattctagtggtggagctatgaacaacaatccgatgtcctgatcgagagcgatggagctaatgtttgaacttgtgaactaaaaatgtgaactatggatgtgaacttatgtaaatttgtgaacttatgcatttggacttatgtgaatttgtgaacttatgtatttggacttgtgtgaatttgtgatatgaacatatatccatgtgtttgaaatctgtattgtatgtgatattctgtgttgcatgtga

//