2021-01-24 06:40:05, GGRNA.v2 : RefSeq release 203 (Nov, 2020)
LOCUS XM_008677110 1573 bp mRNA linear PLN 31-AUG-2020 DEFINITION PREDICTED: Zea mays protein argonaute 1B (LOC103651475), transcript variant X1, mRNA. ACCESSION XM_008677110 VERSION XM_008677110.4 DBLINK BioProject: PRJNA655717 KEYWORDS RefSeq. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_050098.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Aug 31, 2020 this sequence version replaced XM_008677110.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Zea mays Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1573 /organism="Zea mays" /mol_type="mRNA" /cultivar="B73" /db_xref="taxon:4577" /chromosome="3" gene 1..1573 /gene="LOC103651475" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 14 long SRA reads, and 89% coverage of the annotated genomic feature by RNAseq alignments, including 58 samples with support for all annotated introns" /db_xref="GeneID:103651475" CDS 530..1369 /gene="LOC103651475" /codon_start=1 /product="protein argonaute 1B isoform X1" /protein_id="XP_008675332.1" /db_xref="GeneID:103651475" /translation="
MCREHKKTDVQSILVTADILAGRQADAPQEALQVLDIVLRELPTARYSPVGRSFYSPNLGRRQKLGEGLESWRGFYQSIRPTQMGLSLNIDMSSTAFIEPLPVIDFVAQLLNRDISVRPLSDSDRVKIKKALRGVKVEVTGNMRRKYHISGLTSQATRELSFPVDDRGTVKTVVQYFMETYGFSIQHTTLPCLQVGNQQRPNYLPMEVCKIVEGQHYSKRLNEKQITALLKVTCQRPQERELDILQDSGSHQVTPPPHDDFADKCLHSSGGAMNNNPMS"
misc_feature 677..826 /gene="LOC103651475" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:285861" misc_feature 827..1165 /gene="LOC103651475" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(968..970,1013..1015,1046..1048,1058..1060, 1112..1114,1133..1135,1139..1141) /gene="LOC103651475" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" ORIGIN
ttcttttccctctatcgacaccgtgcgcgcacccgcagctacctgcctcgccgccgccctcatacacgcagcgcttcccgccaccgtgcgccttgcacagcggcgtgctgccttcggcacccttgccgcacccctcgaagacgcagcgcttcccgtcgccgtgcgatttgcagtacagggtgctgccctgcgctcccctgcggcagtccgggaactggcaccagctcgcgcgccgccaccagcgcggcccatcctcgccaccccgcggccccccgccgccaccagaaaccggccacgcgtgcccctccgccaccccgcgcgcgccccgctgctccaccgcgcaccaccccgacatggctgaagatgacatggaactatggaagtgggtgttgcttccgaggatcaggacagtgacgacgatgttgatgaggatagaaaggaacaaatttctcattgattttttgagttgggaagtggcaaccacacttcaagtggtggtgctcgtacatctctttgttggactgcatgaatgtgcagggaacacaaaaaaacagatgtacaatcaatcctggtgacagctgatattctagctggaaggcaagcagatgcccctcaggaagctcttcaagtgcttgacattgtactacgtgaattgcctaccgcgaggtattctcctgttggtaggtcattttactctcccaacttagggagacgtcaaaaacttggtgagggattagaaagttggcgtggtttttaccaaagcataaggccgacacagatgggcctttcactgaatattgatatgtcctctactgcatttatcgagcctctccctgtgattgattttgttgctcagcttcttaacagagatatctcagttagaccattatctgattctgatcgcgtgaagattaaaaaagccctaagaggtgtgaaggttgaggtgactggaaacatgcgcagaaaatatcacatttctggcctcacctcacaagcaacaagagagctatcattccctgttgatgatcgtggtactgtgaagactgtggtgcaatacttcatggagacttatggttttagtatccagcacaccactttaccatgcttgcaagtgggcaatcaacaaagaccaaattatctgcctatggaggtttgcaagatagttgaaggacagcattactcaaagagactcaatgagaaacaaatcactgctctactgaaagtgacctgccagcgccctcaagagcgtgagctggacatcttacaggattccggctctcatcaagtgactcctccccctcacgatgactttgcggacaaatgtctccattctagtggtggagctatgaacaacaatccgatgtcctgatcgagagcgatggagctaatgtttgaacttgtgaactaaaaatgtgaactatggatgtgaacttatgtaaatttgtgaacttatgcatttggacttatgtgaatttgtgaacttatgtatttggacttgtgtgaatttgtgatatgaacatatatccatgtgtttgaaatctgtattgtatgtgatattctgtgttgcatgtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]