2024-05-16 11:46:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_008580828 3523 bp mRNA linear MAM 22-JUL-2014 DEFINITION PREDICTED: Galeopterus variegatus nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1), mRNA. ACCESSION XM_008580828 VERSION XM_008580828.1 DBLINK BioProject: PRJNA253111 KEYWORDS RefSeq. SOURCE Galeopterus variegatus (Sunda flying lemur) ORGANISM Galeopterus variegatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Dermoptera; Cynocephalidae; Galeopterus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_007726199.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Galeopterus variegatus Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3523 /organism="Galeopterus variegatus" /mol_type="mRNA" /db_xref="taxon:482537" /chromosome="Unknown" /sex="male" /country="Indonesia: West Java" /collected_by="Minoru Baba" gene 1..3523 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 15 Proteins, and 97% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:103597025" CDS 1..2880 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit" /protein_id="XP_008579050.1" /db_xref="GeneID:103597025" /translation="
MYHMDPLNHPIFNPELFQPEMALSTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGSGGGGTGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGMKHDTESKNGPESCDKSDDREAVTGSGKVIETTEQDKEACESSNGNDEVALTYTVGVKEENAGFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVLDGIINMRNDLYQTPLHLAVITKQEDVVEDLLRTGADLSLLDRLGDSVLHLAAKEGHDKILSVLLKHKKAALLIDHPNGEGLNAIHIAVMNNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALSQMGYTEAIEVIQAAFCTSATAASSPVKTTSQARSLPLSPSSTRQQIDELQDNDSICDSGVETSFHKLSFTESLTSGSSLLTLNKMSHDYRQEGPIEGKI"
misc_feature 82..687 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(124..126,130..135,139..144,151..162,385..387, 391..396,685..687) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 706..1011 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(709..711,715..723,727..735,853..861,898..900, 934..936,991..993,1000..1002,1006..1008) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(715..720,724..726,763..765,769..771,775..777, 874..879,886..888,892..894) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(778..780,784..786,877..882) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature <1561..1785 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1573..1686 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(1696..1698,1708..1713,1720..1728,1732..1737, 1747..1749,1756..1758,1783..1785,1789..1791,1795..1797, 1807..1812,1819..1827,1831..1836,1846..1848,1855..1857, 1891..1893,1897..1899,1903..1905,1915..1920,1927..1935, 1939..1944,1954..1956,1963..1965) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1696..1785 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1705..1989 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1789..1893 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1897..1989 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1912..>2142 /gene="NFKB1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1999..2097 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2395..2619 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
atgtatcatatggatcctttgaatcatccaatatttaatccagagttatttcaaccagagatggcgctgtcaacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtatgtgaaggcccatcccatggtggacttcctggtgcatctagtgaaaagaacaagaagtcctaccctcaggtcaaaatctgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctccatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacctgggtattcttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgacagaggcatgtataaggggctataatcctggacttctggtgcatcctgatcttgcctatttgcaagcagaagggggaggagacaggcagctcacagatcgggaaaaggagctgatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaatgcatccaacttgaaaattgtgagaatggacaggacagctggatgcgtgactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttacgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccccacagacgttcatagacaatttgccattgtcttcaaaactccaaagtataaagatgtcaacattacaaaaccagcctccgtattcgtccaacttcggagaaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttctcggacagttttggcggtggtagtggcgctggagctggaggcggaggcatgtttggtagtggcagtggaggagggggtactggaagtacaggtccagggtatggcttcccacattatgggtttcctacatatggtggaattaccttccatcctggaaccactaaatctaatgctgggatgaagcatgacactgaatctaaaaatggccctgaaagttgtgacaagagtgatgacagagaggctgtaacaggctctgggaaagtaattgaaaccacagaacaagataaggaggcttgcgagtccagcaatgggaacgatgaggttgctctgacgtatacagtgggagtaaaggaagagaatgctgggtttcaggataacctctttctagagaaggcaatgcagcttgccaagcggcatgccaacgcccttttcgactacgcagtgacaggggacgtgaagatgctgctggccgtccagcgccatcttactgcagtgcaggatgagaacggggacagtgtcttacacttagcaatcatccacctccatgctcagcttgtgagggatctgctagaagtcacatctggtttggttcttgatggcatcatcaacatgagaaatgacctttaccagactcccttgcacttggcagtgatcactaagcaggaagatgttgtggaggatttgctgaggactggggctgacctgagtctcctggaccgcctgggtgactctgttttgcacctagctgccaaagaaggacatgataagattctcagtgtcttactcaagcacaaaaaggcagcactacttatcgaccaccccaatggggaaggtcttaatgccattcacatagccgtgatgaacaatagcctgccatgcctgctgctgctggtggccgctggggcagatgtcaacgctcaggagcagaagtctgggcgcacagcactgcacctggctgtggagcacgacaacatctccttggcgggctgcctgctcctggagggtgatgcccatgtggacagtaccacctatgatggaactacacccctgcatatagcagctgggagagggtccacaaggctagcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaaggctggagaggatgaaggagtcgtgcctggaaccacccctctagatatggccaccagctggcaggtgtttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctgaccgaagatgcaaagttgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccctccaagactcttatggacaactatgaggtctcggggggtacagtcaaagagctggtggaggccctgagccagatgggctacaccgaagcgatcgaagtgatccaggcggccttctgcacctcagcaaccgcagcctccagcccagtgaagaccacctctcaggcccgctcgctgcctctctcgccttcctccacacggcagcaaatagatgagcttcaagacaacgacagcatctgtgacagtggcgtggagacatccttccacaaactcagctttacagagtctctgaccagcggcagctcattgctaactcttaacaaaatgtcccatgactacaggcaggaaggacctatagaaggcaaaatttagcccgctggcgagttcccacgcaacgtaaaccagagcgctaaaattccagtgcattgtccaaaggaaggaaggtaaagtgcatccaaaggtgctcagaagaaaactggccgcctgaatcattcttgatttaatccaaggccttttaaatttggcttcctttcttggttcttaaataaattttagcttggtttacctacagatagtatctagcgatcacagcgctcagctgagctggtgcatcgttgagggtgaggtagactattgagctttaccggctgctcctggattacagctgctttctgttgtcattgctgccgtccctctgccgtttcccaccatcattaaaagttatcactgtccccacctggtattctttctagccgtccacagcatggctagatattcacattaaagattaagaaaagggattttttaaaatgatagtactttgcgtgcaataaaaaaggcttattgctttttctctgtgatttgaaaaataaaaaacatgtacttgtcaatatttaaacataattacaatcagtgctgaaaatggtatttccccccttttctgcattttgctattgtaaatatgttttttagatcaaatacttcaaaggaaaaaatgttggatttataaatgcta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]